Entry information : CpapPrx45 (CpPOD29 / evm.model.supercontig_62.46)
Entry ID 8773
Creation 2011-06-28 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2012-08-14 (Christophe Dunand)
Peroxidase information: CpapPrx45 (CpPOD29 / evm.model.supercontig_62.46)
Name (synonym) CpapPrx45 (CpPOD29 / evm.model.supercontig_62.46)
Class Class III peroxidase    [Orthogroup: Prx023]
Taxonomy Eukaryota Viridiplantae Streptophyta Caricaceae Carica
Organism Carica papaya    [TaxId: 3649 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CpapPrx45
start..stop
S start..stop
PpePrx08 498 2e-179 33..342 24..332
MePrx117 492 6e-177 12..342 6..333
RcPrx31 491 2e-176 1..342 1..335
PtPrx80 478 3e-171 35..342 26..337
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 344781..345041 261 N° 2 344441..344632 192 N° 3 344189..344354 166 N° 4 343608..344017 410
complement(join(343608..344017,344189..344354,344441..344632,344781..345041))


exon

Literature and cross-references CpapPrx45 (CpPOD29 / evm.model.supercontig_62.46)
DNA ref. Phytozome 11:   supercontig_62 (345041..343608)
Protein sequence: CpapPrx45 (CpPOD29 / evm.model.supercontig_62.46)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   343
PWM (Da):   %s   38082.08 Transmb domain:   %s   i5-27o
PI (pH):   %s   6.88
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDYKVFLYIILIQTLLVLHLFPLASNAFPSRAYRYPFGYDELNYNFYDQSCPRLPMMVKYGVWSAFQNDSRIAASLLRLHFHDCFVNGCDASLLLDDTDDFKGEKNAFPNRNSVRGFEVIDAIKEDVERFCPETVSCADILALAARDAVLTAGGPFWYVPLGRRDGITASQKAANEQLPSPFEPLQNLTDKFLSKGLDLKDLVVLSGGHTIGFAQCFTFKRRLFDFKGSGKPDPTLDSSALRNLRSMCPNKDIANTNLAPLDYSSTSKFDNSYYANLVNNTGLLESDQALMANPNTAAVVNSYSSNPFLFSRDFATSMIKLGKVGVLTGTDGQIRKTCRFVN

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGACTATAAAGTTTTCTTATACATCATTCTCATCCAAACCCTTCTGGTCCTGCATTTGTTTCCTCTTGCTTCTAATGCCTTCCCTTCTCGCGCATATAGATACCCTTTTGGATATGAC
GAGCTTAATTACAACTTTTACGATCAATCATGTCCTCGATTGCCAATGATGGTTAAATATGGTGTTTGGTCAGCTTTCCAGAACGACTCTAGGATAGCTGCATCCCTTCTTCGGCTGCAC
TTTCACGATTGTTTTGTTAAT
GTAAATTGTTTCTTCCGTTTAGTTTCTTTCATCTTTTTTGAATAATATTGAACCGTTTTTATCAGTTTAAACTTTATTTTTTAAAAAAAAAAAATAGTA
GTTTGAATTATAACTCTTTGCTGTATCTATAATTTTCCTCATGGCGTAGGGCTGTGATGCTTCTCTTCTTCTGGACGACACAGACGATTTCAAAGGGGAGAAAAATGCATTTCCAAACCG
GAATTCAGTACGTGGGTTCGAAGTCATCGATGCAATAAAAGAAGACGTTGAGAGATTTTGCCCGGAAACTGTTTCATGTGCTGATATTCTAGCTCTTGCTGCGAGAGATGCTGTTCTCAC
G
GTTAGCTCTAGGCCGATTTTCTTGCAGAAATCGTCTAATGGTTCCATGTTTTCTTAATTTGGCTTGTCCAACTTCGTGTTGTCCAGGCAGGAGGACCCTTTTGGTATGTTCCACTAGGC
AGAAGAGATGGAATCACAGCTAGTCAAAAAGCAGCTAATGAACAATTACCCTCACCATTTGAACCTTTGCAGAATCTCACAGACAAATTTTTATCTAAAGGACTCGACTTGAAAGATCTG
GTTGTCCTCTCAG
GTAAATTAATTGAAAACTCTCGATCAATTATTTATGTTCTTATACAACTTCTTTATGTATAAGCCCGCTTAGATTTAAATAATTGATTGAACCGATTGTTCTAAAAA
TTTTTAACTTAGAAAAAAATAGTCAATCAATTATTTAAATTCTAACAGGTTATATATCGGACAGGAGGGCATACGATAGGTTTCGCCCAATGCTTCACATTCAAGAGGAGACTTTTCGAC
TTCAAGGGTTCCGGCAAGCCTGACCCGACTCTCGATTCGTCGGCGTTGAGAAACCTAAGGAGCATGTGTCCAAACAAAGACATAGCTAACACCAATCTTGCTCCTCTTGATTATTCAAGT
ACTTCTAAGTTTGATAATTCCTACTATGCAAACCTAGTCAACAACACAGGCCTTCTTGAGTCCGATCAAGCACTGATGGCTAATCCAAACACAGCTGCAGTTGTTAATTCTTATAGTTCA
AACCCTTTTCTCTTCTCCAGAGATTTTGCAACCTCCATGATCAAGCTTGGCAAGGTCGGAGTCTTGACTGGCACGGATGGCCAGATTAGGAAGACATGTAGATTTGTCAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGACTATAAAGTTTTCTTATACATCATTCTCATCCAAACCCTTCTGGTCCTGCATTTGTTTCCTCTTGCTTCTAATGCCTTCCCTTCTCGCGCATATAGATACCCTTTTGGATATGAC
GAGCTTAATTACAACTTTTACGATCAATCATGTCCTCGATTGCCAATGATGGTTAAATATGGTGTTTGGTCAGCTTTCCAGAACGACTCTAGGATAGCTGCATCCCTTCTTCGGCTGCAC
TTTCACGATTGTTTTGTTAAT
GGCTGTGATGCTTCTCTTCTTCTGGACGACACAGACGATTTCAAAGGGGAGAAAAATGCATTTCCAAACCGGAATTCAGTACGTGGGTTCGAAGTCATC
GATGCAATAAAAGAAGACGTTGAGAGATTTTGCCCGGAAACTGTTTCATGTGCTGATATTCTAGCTCTTGCTGCGAGAGATGCTGTTCTCACG
GCAGGAGGACCCTTTTGGTATGTTCCA
CTAGGCAGAAGAGATGGAATCACAGCTAGTCAAAAAGCAGCTAATGAACAATTACCCTCACCATTTGAACCTTTGCAGAATCTCACAGACAAATTTTTATCTAAAGGACTCGACTTGAAA
GATCTGGTTGTCCTCTCAG
GAGGGCATACGATAGGTTTCGCCCAATGCTTCACATTCAAGAGGAGACTTTTCGACTTCAAGGGTTCCGGCAAGCCTGACCCGACTCTCGATTCGTCGGCG
TTGAGAAACCTAAGGAGCATGTGTCCAAACAAAGACATAGCTAACACCAATCTTGCTCCTCTTGATTATTCAAGTACTTCTAAGTTTGATAATTCCTACTATGCAAACCTAGTCAACAAC
ACAGGCCTTCTTGAGTCCGATCAAGCACTGATGGCTAATCCAAACACAGCTGCAGTTGTTAATTCTTATAGTTCAAACCCTTTTCTCTTCTCCAGAGATTTTGCAACCTCCATGATCAAG
CTTGGCAAGGTCGGAGTCTTGACTGGCACGGATGGCCAGATTAGGAAGACATGTAGATTTGTCAACTGA

Retrieve as FASTA