Entry information : CpapPrx54 (evm.model.supercontig_75.24)
Entry ID 8779
Creation 2011-06-28 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-05 (Qiang LI)
Peroxidase information: CpapPrx54 (evm.model.supercontig_75.24)
Name (synonym) CpapPrx54 (evm.model.supercontig_75.24)
Class Class III peroxidase    [Orthogroup: Prx005]
Taxonomy Eukaryota Viridiplantae Streptophyta Caricaceae Carica
Organism Carica papaya    [TaxId: 3649 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CpapPrx54
start..stop
S start..stop
RcPrx09 513 0 7..325 4..321
CclPrx45 508 0 7..325 7..322
CsPrx29 508 0 10..325 1..314
PtPrx78 504 0 8..325 5..321
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 301263..301472 210 N° 2 301549..301728 180 N° 3 301840..302005 166 N° 4 302435..302856 422
join(301263..301472,301549..301728,301840..302005,302435..302856)


exon

Literature and cross-references CpapPrx54 (evm.model.supercontig_75.24)
DNA ref. Phytozome 11:   supercontig_75 (301263..302856)
Protein sequence: CpapPrx54 (evm.model.supercontig_75.24)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   326 (304)
PWM (Da):   %s   35793.83 (33410.6)  
PI (pH):   %s   5.92 (5.68) Peptide Signal:   %s   cut: 22 range:22-325
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGISSNYWVLLLGIALQSVHSQEGLSNGYYSSSCPEAESIVRSTVEYHFKNDPSIAPALLRLHFHDCFVQGCDGSVLITGSSSERSAFPNLGLRGFQVIEDAKSQLELSCPGVVSCADIVALAARDAVDLSDGPSWKVPTGRRDGRISSSSQVTSSLPSPLDSVYVQRQKFAAKGLDDHDLVTLVGAHTIGKTDCRFFKYRLYNFTRTGNSDPTINQPFLAQLKSVCPQNGDGLNEVPLDKDTPDKFDVSFFKNLRDGTGVLESDQRLWDDAATREVVRKYAGTFRGLLGLRFDHEFSQAMIKMSSIEVKTGYEGEIREVCYKFN

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGAATTAGCAGTAATTACTGGGTATTACTTTTGGGTATAGCCTTACAATCAGTTCACAGCCAAGAAGGGTTAAGCAATGGGTATTACTCTTCTTCTTGCCCAGAAGCTGAGTCCATT
GTAAGGTCTACTGTTGAGTACCACTTCAAGAACGACCCCTCCATTGCTCCTGCCTTGCTCAGGCTCCATTTCCATGACTGTTTCGTCCAG
GTAATTTTTCTTTTAAACTAATTTTTCATA
ATTAAGTGCTTGATTATTATTAACCACACCAATTAATTGTATATAGGGATGCGATGGTTCGGTGCTGATCACAGGATCATCGTCTGAGAGAAGTGCGTTTCCGAATCTTGGGTTGAGAGG
ATTTCAAGTAATTGAAGATGCAAAATCACAGCTCGAGTTGTCCTGTCCTGGTGTAGTTTCCTGTGCTGATATTGTTGCTCTTGCAGCTCGTGATGCTGTTGATTTG
GTATAATCTTTACA
CATATAAAATTAATTTAAAAATATTATTATGGGTTAAATTGAAAAAGAAATTTAATACAAACTAGGTTAAATTGTAATTGGATTTCATATGTTGCAGAGTGATGGTCCGAGTTGGAAAGT
GCCAACAGGGAGAAGAGATGGGAGGATTTCTTCATCATCCCAAGTGACCTCAAGCTTACCTTCCCCTCTTGATTCTGTTTATGTTCAGAGGCAAAAGTTTGCAGCTAAAGGCCTTGATGA
TCATGATCTTGTAACCCTAGTTG
GTACTAATTTTGCTTCTTGATTGATTAAATTCCTATTCAATTACAATTCTTAATATATATATATATAATTGAGTTATATACTTGTATATGTCTAAAT
CTTAAAATTAATATATATGCATAGATTTTTAGTTAAAACAAAATTTGAGCCATTCTAATTGAAATAATTTATCTTATATATTTTTACAATGGACCCAATTGATAAATTACATATAACTAG
CCGTTATACTTGACAATTTTTTTCCTTTAAAATTTCTTACTTTACCATTATTTTCATTTTTGTTCTCTTTATTATAAACCAACTTATATAATTTTATGAGTAAAACACATTTAAATTTTA
AAAATAAAAACTAAATTAAAAATTAAAAAAAAAAAAAAACAGTTCTATAGGTATAATACAATTCATGTTGTTGATGATACGGATGGATGCAGGGGCGCACACCATAGGCAAAACAGACTG
CAGATTTTTCAAATACCGTCTCTACAACTTCACGAGGACCGGAAATTCAGACCCAACCATTAACCAACCCTTTCTGGCTCAACTCAAATCGGTATGCCCCCAAAACGGAGATGGACTTAA
CGAGGTTCCATTGGACAAAGACACTCCCGACAAGTTTGATGTGAGCTTCTTCAAGAACCTCCGAGACGGTACCGGCGTTTTGGAGTCGGATCAGAGGCTTTGGGACGACGCTGCTACTCG
AGAGGTTGTGCGAAAGTATGCTGGCACTTTCAGGGGTTTGCTGGGTTTGAGATTTGATCATGAGTTTTCACAGGCGATGATTAAAATGAGCAGCATTGAAGTGAAGACTGGATATGAAGG
GGAAATTAGAGAAGTCTGCTACAAGTTTAATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGAATTAGCAGTAATTACTGGGTATTACTTTTGGGTATAGCCTTACAATCAGTTCACAGCCAAGAAGGGTTAAGCAATGGGTATTACTCTTCTTCTTGCCCAGAAGCTGAGTCCATT
GTAAGGTCTACTGTTGAGTACCACTTCAAGAACGACCCCTCCATTGCTCCTGCCTTGCTCAGGCTCCATTTCCATGACTGTTTCGTCCAG
GGATGCGATGGTTCGGTGCTGATCACAGGA
TCATCGTCTGAGAGAAGTGCGTTTCCGAATCTTGGGTTGAGAGGATTTCAAGTAATTGAAGATGCAAAATCACAGCTCGAGTTGTCCTGTCCTGGTGTAGTTTCCTGTGCTGATATTGTT
GCTCTTGCAGCTCGTGATGCTGTTGATTTG
AGTGATGGTCCGAGTTGGAAAGTGCCAACAGGGAGAAGAGATGGGAGGATTTCTTCATCATCCCAAGTGACCTCAAGCTTACCTTCCCCT
CTTGATTCTGTTTATGTTCAGAGGCAAAAGTTTGCAGCTAAAGGCCTTGATGATCATGATCTTGTAACCCTAGTTG
GGGCGCACACCATAGGCAAAACAGACTGCAGATTTTTCAAATAC
CGTCTCTACAACTTCACGAGGACCGGAAATTCAGACCCAACCATTAACCAACCCTTTCTGGCTCAACTCAAATCGGTATGCCCCCAAAACGGAGATGGACTTAACGAGGTTCCATTGGAC
AAAGACACTCCCGACAAGTTTGATGTGAGCTTCTTCAAGAACCTCCGAGACGGTACCGGCGTTTTGGAGTCGGATCAGAGGCTTTGGGACGACGCTGCTACTCGAGAGGTTGTGCGAAAG
TATGCTGGCACTTTCAGGGGTTTGCTGGGTTTGAGATTTGATCATGAGTTTTCACAGGCGATGATTAAAATGAGCAGCATTGAAGTGAAGACTGGATATGAAGGGGAAATTAGAGAAGTC
TGCTACAAGTTTAATTGA

Retrieve as FASTA