Entry information : CpapPrx60 (CpPOD32 / evm.model.supercontig_9.151)
Entry ID 8785
Creation 2011-06-28 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2012-08-14 (Christophe Dunand)
Peroxidase information: CpapPrx60 (CpPOD32 / evm.model.supercontig_9.151)
Name (synonym) CpapPrx60 (CpPOD32 / evm.model.supercontig_9.151)
Class Class III peroxidase    [Orthogroup: Prx014]
Taxonomy Eukaryota Viridiplantae Streptophyta Caricaceae Carica
Organism Carica papaya    [TaxId: 3649 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CpapPrx60
start..stop
S start..stop
RcPrx88 481 7e-173 1..324 1..321
GmPrx138 475 2e-170 1..324 3..323
VvPrx54 474 2e-170 1..324 1..322
EcamPrx176 470 9e-169 5..324 6..325
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 930852..931064 213 N° 2 929993..930184 192 N° 3 929662..929827 166 N° 4 929046..929449 404
complement(join(929046..929449,929662..929827,929993..930184,930852..931064))


exon

Literature and cross-references CpapPrx60 (CpPOD32 / evm.model.supercontig_9.151)
DNA ref. Phytozome 11:   supercontig_9 (931064..929046)
Protein sequence: CpapPrx60 (CpPOD32 / evm.model.supercontig_9.151)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   325 (301)
PWM (Da):   %s   35648.21 (32986.7) Transmb domain:   %s   o4-26i
PI (pH):   %s   7.95 (7.75) Peptide Signal:   %s   cut: 24 range:24-324
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRTIFVLFVSTILLLNVIVSCQGGPLRKKFYRDTCPKAEDIVNDVTSKHVARNPAVAAQLLRMHFHDCFVRGCDGSVLIDSTPNNSAERDAIPNQTLLGFDVIDDIKKQVEKACPGVVSCADILALAARDSVSFSFDKPMWEVLTGRRDGRISIEVEALTQIPSPFMNFTALKQNFAAKGLTVHDLVVLSGGHTIGVSHCAGFTNRLFNFTGKGDQDPTLDPKYAAFLKTKCRNPSDTTTVVDMDPKSAEDFDSHYYKILLQNKGLFQSDAALLTNKGSKNIVNELLNQEKFFTEFAQSMKRMGAVEVLAGTAGEIRKKCNVIN

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGAACTATATTCGTCTTATTCGTTTCGACTATACTTTTATTGAATGTTATTGTAAGTTGTCAAGGAGGTCCTTTAAGAAAAAAATTCTATCGAGATACATGTCCGAAGGCAGAGGAT
ATTGTGAATGATGTCACTTCCAAACATGTTGCAAGAAACCCTGCCGTGGCCGCGCAACTCCTAAGGATGCATTTTCACGATTGTTTCGTCCGG
GTAATTAATAGATGATGCATTTTTGTA
GATTATAAATATTATACTAAATATATCATGACACCGACCAAATATGCTTATTTATAGTAGTTTATATATTTATTGAACTTTTTTTTTTTTCTGAACATAGAAAGTAGTGTAAAAGTTTTT
TAGTAAAAAAATTAAAATAATGTTAGAGACAAGTATAACTCGTAGTTTGGTCATGCATGGTATTTTGTCAAAATTTTGAATGTCTCGTATATGATCATATATACACTACGTATAAAGGGA
GAATAATAAGAGATGTAATCTCACGTCAATCATGTACGATAAGTTATATAATTATCGAATAACTTTATCTTATAATATATGTTTTTTTTAATAATAATTTAACGCGCTACAAGGAAAAAA
GAATTTACAACATATAATCATTGATTGATTTGTAACTTGGATTCATGATTCCATTCTCTTATATAAGGTAAGATTGCGAGAGTTTCTCATGAATATCTTAGTTTTATATGGATAATTTGT
GTTTTAACCGTACTAAAAATTAAGATATAAGTTTCGTATCCGTGATCTAATATGTAAATAAAATAATTCACGATTTTTAAAAAAATAATATTATCGCAAGTATATATATTTGTTATCGCT
AATTAAGTCAATGAACTAATTGAACTTTTACGAATTTCAGGGTTGTGATGGGTCTGTTCTAATAGACTCAACTCCGAATAATTCAGCAGAAAGAGATGCAATTCCAAACCAGACACTATT
AGGTTTTGATGTCATTGATGACATAAAAAAACAAGTTGAAAAGGCATGTCCAGGAGTTGTGTCTTGTGCTGATATATTGGCTCTGGCTGCTAGAGATTCAGTGTCTTTCTCA
GTAAGTTA
TATATATGCACGTACTTATGTGTGTGTGTATATATATTCTATAAAGAAGATTAGTGTAGCTATAGACTTGTTAATTATAAGAATCTTAATCATGTATATTGTAAAGTTTCTACTTTTAAG
TATTTATCTCTAATACCTTTTTTTTTTTTCATTTCAGTTTGATAAACCTATGTGGGAAGTACTTACTGGCAGAAGAGATGGCAGAATATCAATTGAGGTAGAAGCTCTTACTCAGATCCC
ATCACCTTTCATGAACTTCACTGCTCTCAAACAGAATTTCGCAGCCAAAGGTCTCACTGTACATGACCTTGTAGTTCTATCAG
GTAATTGTAATTATATACATGTATATATACATATATA
TATGCTAACTAAGTCTATTATGAATGTTCTTGGCTTACCTATATTGAGTGGAAACATATGGACTATTGGGTCATTCGGATCACTTTGGTGCATGTAGTATGATACTTCAACAATTTGTAT
ATTGTATATATATATATATATAAACGAACTTATCATGTTGATCTTATTATTTTAGGCGGACACACAATTGGAGTCTCCCACTGCGCTGGTTTTACTAACAGGCTTTTTAACTTCACTGGG
AAAGGAGACCAGGATCCTACATTAGACCCAAAATATGCTGCTTTCTTGAAGACTAAATGCAGAAATCCCAGTGACACTACAACTGTGGTAGACATGGATCCTAAGAGTGCCGAGGATTTT
GACAGTCATTACTACAAGATCCTCCTGCAAAACAAAGGATTGTTTCAGTCTGACGCTGCGCTTCTAACGAACAAAGGTTCAAAAAATATTGTCAACGAATTACTCAACCAGGAGAAATTC
TTTACCGAGTTTGCTCAGTCAATGAAGAGAATGGGAGCCGTCGAGGTCCTCGCCGGCACAGCTGGAGAGATTAGGAAGAAATGCAATGTTATTAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGAACTATATTCGTCTTATTCGTTTCGACTATACTTTTATTGAATGTTATTGTAAGTTGTCAAGGAGGTCCTTTAAGAAAAAAATTCTATCGAGATACATGTCCGAAGGCAGAGGAT
ATTGTGAATGATGTCACTTCCAAACATGTTGCAAGAAACCCTGCCGTGGCCGCGCAACTCCTAAGGATGCATTTTCACGATTGTTTCGTCCGG
GGTTGTGATGGGTCTGTTCTAATAGAC
TCAACTCCGAATAATTCAGCAGAAAGAGATGCAATTCCAAACCAGACACTATTAGGTTTTGATGTCATTGATGACATAAAAAAACAAGTTGAAAAGGCATGTCCAGGAGTTGTGTCTTGT
GCTGATATATTGGCTCTGGCTGCTAGAGATTCAGTGTCTTTCTCA
TTTGATAAACCTATGTGGGAAGTACTTACTGGCAGAAGAGATGGCAGAATATCAATTGAGGTAGAAGCTCTTACT
CAGATCCCATCACCTTTCATGAACTTCACTGCTCTCAAACAGAATTTCGCAGCCAAAGGTCTCACTGTACATGACCTTGTAGTTCTATCAG
GCGGACACACAATTGGAGTCTCCCACTGC
GCTGGTTTTACTAACAGGCTTTTTAACTTCACTGGGAAAGGAGACCAGGATCCTACATTAGACCCAAAATATGCTGCTTTCTTGAAGACTAAATGCAGAAATCCCAGTGACACTACAACT
GTGGTAGACATGGATCCTAAGAGTGCCGAGGATTTTGACAGTCATTACTACAAGATCCTCCTGCAAAACAAAGGATTGTTTCAGTCTGACGCTGCGCTTCTAACGAACAAAGGTTCAAAA
AATATTGTCAACGAATTACTCAACCAGGAGAAATTCTTTACCGAGTTTGCTCAGTCAATGAAGAGAATGGGAGCCGTCGAGGTCCTCGCCGGCACAGCTGGAGAGATTAGGAAGAAATGC
AATGTTATTAATTAA

Retrieve as FASTA