Entry information : CpapPrx61 (evm.model.supercontig_9.35)
Entry ID 8786
Creation 2011-06-28 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-05 (Qiang LI)
Peroxidase information: CpapPrx61 (evm.model.supercontig_9.35)
Name (synonym) CpapPrx61 (evm.model.supercontig_9.35)
Class Class III peroxidase    [Orthogroup: Prx032]
Taxonomy Eukaryota Viridiplantae Streptophyta Caricaceae Carica
Organism Carica papaya    [TaxId: 3649 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CpapPrx61
start..stop
S start..stop
GhPrx37 487 4e-175 9..332 7..330
VvPrx19 485 4e-174 1..332 1..333
PtPrx17 483 2e-173 9..332 12..337
MePrx62 481 1e-172 5..332 7..335
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 146516..146755 240 N° 2 146246..146437 192 N° 3 145998..146163 166 N° 4 145457..145860 404
complement(join(145457..145860,145998..146163,146246..146437,146516..146755))


exon

Literature and cross-references CpapPrx61 (evm.model.supercontig_9.35)
DNA ref. Phytozome 12:   supercontig_9 (146755..145457)
Protein sequence: CpapPrx61 (evm.model.supercontig_9.35)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   333 (316)
PWM (Da):   %s   35931.76 (33886.7)  
PI (pH):   %s   4.26 (4.25) Peptide Signal:   %s   cut: 18 range:18-333
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVDYFVFYLLVLRLAMASMSNTLNETCLDDVGVALDVKWYQNSCPEAKSIVFSWVENAIYQDSRMAASLLRLHFHDCFVNGCDASVLLDDAGTFIGEKSAAPNLNSLRGFEVINGIKSELESVCPETVSCADILAMAARDSVVLSGGPSWEVLMGRRDSLSASKAAANNNIPAPNSTVPTLVTMFKNVGLDIKDLVVLSGGHTLGKARCSTFSSRFQGTATSPDVNLEFLQALQQICSVPNAGNTALAQLDLVTPATFDNQYYINLISGEGLLPSDQALLTEDDETRELVELYADDPISFFEDFTKSMLKMGNLGPLTGSSGEIRRNCRTVNL

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTGGACTATTTCGTCTTTTACTTGCTTGTGCTTAGGCTTGCAATGGCAAGCATGTCAAACACCTTAAATGAAACATGCCTTGACGATGTAGGTGTTGCATTGGACGTCAAATGGTAC
CAAAACAGCTGCCCAGAAGCAAAATCTATAGTGTTCTCATGGGTCGAAAATGCAATCTATCAGGACTCTAGAATGGCGGCTTCACTACTTCGGCTTCATTTTCATGACTGCTTCGTCAAT
GCATGTTTACTCTTACTCGAATCAATCGCATCTCTATTTTTGCACTTTTATCTGTTATGATTTGAGTTAAAATTGCAGGGATGTGATGCTTCAGTGCTGTTGGATGATGCTGGCACTTTT
ATTGGAGAAAAAAGTGCAGCGCCCAACCTGAATTCTCTAAGAGGATTTGAAGTGATCAACGGGATAAAATCTGAACTGGAATCTGTTTGCCCCGAAACTGTCTCCTGTGCTGATATTCTG
GCAATGGCGGCTAGAGACTCCGTTGTTCTA
GTGAGTACTACCCCCCAGCTTCGAGTAACAATAATAATAACAATAATAATAAGTTTCGGTTAAAGAATTTTAAAAAATGCAGTCAGGAGG
ACCAAGCTGGGAGGTGCTAATGGGGAGGAGAGACAGCTTAAGTGCGAGCAAAGCAGCAGCAAACAACAACATACCGGCCCCTAATTCTACAGTCCCAACCCTTGTTACCATGTTTAAGAA
CGTTGGCCTTGACATCAAGGACCTGGTTGTGCTCTCGG
GTAAATCTCATCATCCCCTCCCACACTTCTTTTTTCATACATGAACATCGGCCAAAAATTTATGATTTCTTTCCAAAGACCC
CTCAGCTTCTTAGATATATAGTAGCATTGACAAGGCAACATTAAAATTGTGGCAGGTGGGCATACACTGGGAAAGGCTCGATGCTCGACATTTAGCTCCCGTTTCCAGGGAACAGCCACT
AGCCCAGATGTTAACTTGGAGTTCCTTCAAGCATTGCAGCAGATATGTTCAGTACCCAATGCTGGCAACACTGCGTTGGCACAACTTGACCTGGTTACCCCAGCAACATTCGACAACCAG
TACTACATTAACCTCATATCTGGCGAGGGATTGCTGCCATCAGATCAAGCTCTTCTTACTGAAGATGATGAAACACGTGAGCTTGTAGAGTTGTATGCTGACGACCCAATTTCCTTCTTC
GAAGACTTCACCAAATCCATGCTCAAAATGGGAAACTTGGGGCCACTAACAGGGTCCAGTGGAGAGATAAGGAGAAATTGCAGAACCGTTAATCTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTGGACTATTTCGTCTTTTACTTGCTTGTGCTTAGGCTTGCAATGGCAAGCATGTCAAACACCTTAAATGAAACATGCCTTGACGATGTAGGTGTTGCATTGGACGTCAAATGGTAC
CAAAACAGCTGCCCAGAAGCAAAATCTATAGTGTTCTCATGGGTCGAAAATGCAATCTATCAGGACTCTAGAATGGCGGCTTCACTACTTCGGCTTCATTTTCATGACTGCTTCGTCAAT
GGATGTGATGCTTCAGTGCTGTTGGATGATGCTGGCACTTTTATTGGAGAAAAAAGTGCAGCGCCCAACCTGAATTCTCTAAGAGGATTTGAAGTGATCAACGGGATAAAATCTGAACTG
GAATCTGTTTGCCCCGAAACTGTCTCCTGTGCTGATATTCTGGCAATGGCGGCTAGAGACTCCGTTGTTCTA
TCAGGAGGACCAAGCTGGGAGGTGCTAATGGGGAGGAGAGACAGCTTA
AGTGCGAGCAAAGCAGCAGCAAACAACAACATACCGGCCCCTAATTCTACAGTCCCAACCCTTGTTACCATGTTTAAGAACGTTGGCCTTGACATCAAGGACCTGGTTGTGCTCTCGG
GT
GGGCATACACTGGGAAAGGCTCGATGCTCGACATTTAGCTCCCGTTTCCAGGGAACAGCCACTAGCCCAGATGTTAACTTGGAGTTCCTTCAAGCATTGCAGCAGATATGTTCAGTACCC
AATGCTGGCAACACTGCGTTGGCACAACTTGACCTGGTTACCCCAGCAACATTCGACAACCAGTACTACATTAACCTCATATCTGGCGAGGGATTGCTGCCATCAGATCAAGCTCTTCTT
ACTGAAGATGATGAAACACGTGAGCTTGTAGAGTTGTATGCTGACGACCCAATTTCCTTCTTCGAAGACTTCACCAAATCCATGCTCAAAATGGGAAACTTGGGGCCACTAACAGGGTCC
AGTGGAGAGATAAGGAGAAATTGCAGAACCGTTAATCTCTAA

Retrieve as FASTA