Entry information : CpapPrx63 (CpPOD33 / evm.model.supercontig_98.23)
Entry ID 8788
Creation 2011-06-28 (Qiang Li)
Last sequence changes 2012-01-05 (Qiang LI)
Sequence status partial
Reviewer Christophe Dunand
Last annotation changes 2012-08-14 (Christophe Dunand)
Peroxidase information: CpapPrx63 (CpPOD33 / evm.model.supercontig_98.23)
Name (synonym) CpapPrx63 (CpPOD33 / evm.model.supercontig_98.23)
Class Class III peroxidase     [Orthogroup: Prx026]*
Taxonomy Eukaryota Viridiplantae Streptophyta Caricaceae Carica
Organism Carica papaya    [TaxId: 3649 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CpapPrx63
start..stop
S start..stop
PtPrx61 328 3e-114 5..217 7..219
PtPrx19 327 1e-113 10..225 14..229
CsPrx02 322 7e-111 8..217 74..283
ThasPrx13 322 2e-110 1..231 70..302
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 512361..512531 171 N° 2 512728..512916 189 N° 3 513000..513165 166 N° 4 514070..514236 167
join(512361..512531,512728..512916,513000..513165,514070..514236)


exon

Literature and cross-references CpapPrx63 (CpPOD33 / evm.model.supercontig_98.23)
DNA ref. Phytozome 11:   supercontig_98 (512361..514236)
Protein sequence: CpapPrx63 (CpPOD33 / evm.model.supercontig_98.23)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   231
PWM (Da):   %s   25024.46  
PI (pH):   %s   4.81
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSRAVDPPPRSLEYDFYRDSCTGAEQKIRSVVTELYRLNSSVAPALLRLAFHDCFIQGCDASILLDPAEGIESEKDSPPNQSLKGFNVMDIIKSQIEEACPGVVSCSDILVLAARDGVVLAGGPFYPLCTGRRDSHVSFMDAATYDLPAPNADLPETLASFASRGFDERETVSLLGAHSIGVIHCKFYQNRLYNFAGTVKPDPSLDPELLKELRSKCIPSQRTTSPAPSP

Retrieve as FASTA  
Remarks Patial sequence from genomic. Incorrect prediction from phytozome (3' end is missing due to NNNNNNNNNNN in DNA sequence). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCACGTGCGGTAGACCCTCCTCCTCGATCCCTTGAGTACGATTTTTATCGAGATTCATGTACAGGAGCCGAGCAGAAGATTCGATCCGTTGTCACGGAACTGTACAGGCTTAACTCA
AGTGTAGCTCCTGCTCTCTTGCGCCTTGCTTTTCACGATTGCTTTATTCAG
GTGAACCTTCTTTCATTTTCTGTTTTTTTGATTGTTTGGGAAAGTCCGCTTGATTATTAATTTCAAATA
TAGTTCAAATCAAGGACGAATTTGTAGAATTCTCATACATGTTATCTAATTTTTTCAGTTGCGTGATTTTTGCTTCAGATTTATGAGAAATTTGTTTCTCTGATACAGTATTGGTTCAAT
TGGGTAGGGATGTGATGCGTCTATCTTACTGGATCCTGCGGAAGGTATTGAGTCAGAGAAAGATTCTCCTCCTAATCAATCTTTAAAAGGTTTTAATGTAATGGACATAATCAAATCTCA
GATTGAAGAAGCATGTCCTGGTGTAGTTTCCTGTTCAGATATTCTTGTATTGGCAGCAAGAGACGGTGTCGTTTTG
GCAAGTCCTTACTCTCTCTCTCTCGCTCCCTCTCTCATCTAATA
ATTTTCTCTGGTATAAATCACTAAATCTTCGAATTCCAGGCTGGTGGCCCATTCTATCCACTGTGTACAGGCCGGAGAGATAGCCATGTGAGCTTCATGGACGCTGCGACGTATGACCTT
CCTGCACCCAATGCTGACCTTCCGGAGACTCTTGCATCTTTTGCATCCAGGGGATTTGATGAAAGAGAGACTGTTAGTCTCCTAG
GTACAAAATACGTATTTTTCCTACTCTAGCCAGCT
TGACCTCCTTTTCGGGATTATTACATCTTTTTGCTAATGAAACTGAAAACTGTTTTTTCTTTCTTGATTGGCTAACCTTAAAGCTGTTAAGAGTTGTTAGATTTTCTGTAGAAAGTATTA
TTGTTTTTCGTAATGCAGAAATAAATTGTGGAAGATAAATTACATTACTTGTTAAAAGGAAATGTATACTGTTAAACAGTAAGATCTTGTGTGTTAAAAATAATAATAATAATAATAATG
AAGTATTGAACATATTACAAGTTAGGAGAAGTTTGACCTTTTCTCCGGAATTTTTACATGTTTTTGCAAATGATGAAACTTGTTCGAGTTATGAGAATTTTTCCATTAAGTATTTTTTTT
TTATAATATATCGATAAATGTTGCCAAAAATAAGTCAAATGGTGTATGCACAAACGCAATGCAAATCCATCGAGTTGAAAGAAGTTCTTCAATATGAGTTCTCTCCTTCTCTAATAAAGA
AGAATGATAAATATGACTTATTTCAAATGAGAGTAATCTTGATCTATGAGCTATAACAAAATTTTGTATCCTCTTTTTTCTTTATCATTTTTCAAGTTTTCGGTCAAAAAAATGTTCTTT
GTTATTTCTTGATCAAGATACCTGCTGGAACTGGATCCATGAAAATTTTTCTTCTGTGAAAAAACACTACCATATGTTTGACTTGAATAGTGTTTGATTCTATTAGTATGCTGGAAAATA
TTGTTCCACATTCCCCCCAAACTGGTGGTTTTGCTCTTCTTCAGTTTGTATCACAGAAATTGGCGCACTAGCTTATGGTTGTTTCTCTTTCTTCATGCGCAAGAAATAATGCCATCCCAC
CTTCACCTTATAACTCTTCTTTTCTTCAGGTGCTCACAGCATTGGAGTAATCCACTGCAAATTCTACCAAAACCGCCTTTACAATTTCGCAGGAACTGTCAAGCCAGACCCTTCTCTGGA
TCCAGAATTACTTAAAGAACTAAGGTCAAAATGTATTCCCAGCCAGAGAACAACCTCACCAGCACCATCTCCATTT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCACGTGCGGTAGACCCTCCTCCTCGATCCCTTGAGTACGATTTTTATCGAGATTCATGTACAGGAGCCGAGCAGAAGATTCGATCCGTTGTCACGGAACTGTACAGGCTTAACTCA
AGTGTAGCTCCTGCTCTCTTGCGCCTTGCTTTTCACGATTGCTTTATTCAG
GGATGTGATGCGTCTATCTTACTGGATCCTGCGGAAGGTATTGAGTCAGAGAAAGATTCTCCTCCTAAT
CAATCTTTAAAAGGTTTTAATGTAATGGACATAATCAAATCTCAGATTGAAGAAGCATGTCCTGGTGTAGTTTCCTGTTCAGATATTCTTGTATTGGCAGCAAGAGACGGTGTCGTTTTG
GCTGGTGGCCCATTCTATCCACTGTGTACAGGCCGGAGAGATAGCCATGTGAGCTTCATGGACGCTGCGACGTATGACCTTCCTGCACCCAATGCTGACCTTCCGGAGACTCTTGCATCT
TTTGCATCCAGGGGATTTGATGAAAGAGAGACTGTTAGTCTCCTAG
GTGCTCACAGCATTGGAGTAATCCACTGCAAATTCTACCAAAACCGCCTTTACAATTTCGCAGGAACTGTCAAG
CCAGACCCTTCTCTGGATCCAGAATTACTTAAAGAACTAAGGTCAAAATGTATTCCCAGCCAGAGAACAACCTCACCAGCACCATCTCCATTT

Retrieve as FASTA