Entry information : CpapPrx65 (evm.TU.contig_36964.1)
Entry ID 8789
Creation 2011-06-28 (Qiang Li)
Last sequence changes 2015-12-02 (Christophe Dunand)
Sequence status partial
Reviewer Achraf Jemmat
Last annotation changes 2015-12-02 (Achraf Jemmat)
Peroxidase information: CpapPrx65 (evm.TU.contig_36964.1)
Name (synonym) CpapPrx65 (evm.TU.contig_36964.1)
Class Class III peroxidase     [Orthogroup: Prx005]*
Taxonomy Eukaryota Viridiplantae Streptophyta Caricaceae Carica
Organism Carica papaya    [TaxId: 3649 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CpapPrx65
start..stop
S start..stop
CpapPrx38 433 4e-155 1..262 65..327
GhPrx06 404 9e-144 1..262 66..328
RcPrx54 401 2e-142 1..262 62..324
NtPrx10-1B 397 6e-141 1..262 69..330
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3..208 206 N° 2 320..482 163 N° 3 580..1001 422  
join(3..208,320..482,580..1001)


exon

Literature and cross-references CpapPrx65 (evm.TU.contig_36964.1)
DNA ref. Phytozome 11:   contig_36964 (32..1001)
Protein sequence: CpapPrx65 (evm.TU.contig_36964.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   263
PWM (Da):   %s   28276.47  
PI (pH):   %s   7.25
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ECIFMIVFVEL*CFNSS*WT*H*ENCCS*SSFKRF*CY*RC*SKA*DVMSWSCFVR*YSYSCCS*FCGSD*WRKLESTDGT*RWDHFIGIRNYQLARIY*LS*CAKTKIC*QGTQYPRSRHSRWTYNWYCRMCCNYG*II*F*WNSWSI*SCHKPFIPSYIKSSLPSKR*CKKTCST*HRE*K*I*YIFL*KLKRW*RSYSI*SSTMD*YLY*NLRSTLFGY*RPSWINFQYRIWKINGENE*Y*SENRY*R*NQKSLQIYX

Retrieve as FASTA  
Remarks Partial sequence from genomic. Incorrect prediction from phytozome (Partial exon 1 is missing (contig end)).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GAATGCATTTTCATGATTGTTTTTGTCGAGTTGTGATGCTTCAATTCTTCTTGATGGACCTAGCACTGAGAAAACTGCTGTTCCTAATCTTCTTTTAAGAGGTTTTAATGTTATTGAAGA
TGCTAAAGCAAAGCTTGAGATGTTATGTCCTGGAGTTGTTTCGTGCGCTGATATTCTTACTCTTGCTGCTCGTGATTCTGTGGTTC
TGGTAATTATTAATCAAACATATTCTTTCCTTTT
TATTTACCTTACTACATTTATATAATTATAATATTTAAGTTGATGCATTTTGATATTTAATATATGTATATGAATGCAGACTAGTGGCGTAAGTTGGAGAGTACCGATGGGACGTAGAGA
TGGGATCATTTCATTGGCATCCGAAACTACCAACTTGCCAGGATTTATTGACTCAGTTGATGTGCAAAAACAAAAATTTGCTGACAAGGGACTCAATATCCAAGATCTCGTCACTCTTGT
CGGTGAGTGTTGTTTCGAAATTTTTATTATACCACTTTATTAATTATGTATGATTTGTTCTACTTATTTACTAAGTATTTTTTTTTTTTTTATAATTAGGTGGACATACAATTGGTACTG
CAGGATGTGCTGTAATTACGGGTAGATTATTTAATTTTAATGGAACAGCTGGAGCATCTGATCCTGCCATAAGCCCTTCATTCCTTCCTACATTAAAAGCTCTTTGCCCTCAAAACGGTG
ATGCAAGAAAACGTGTAGCACTTGACACAGAGAGTGAAAATGAATTTGATACATCTTTCTTTAAAAACTTAAGAGATGGTAAAGGAGTTATTCAATCTGATCAAGCACTATGGACTGATA
CCTCTACTAAAACCTTCGTTCAACGCTTTTTGGGTATTAGAGGCCTTCTTGGATTAACTTTCAATATCGAATTTGGAAAATCAATGGTGAAAATGAGTAATATTGAAGTGAAAACAGGTA
CTGAAGGTGAAATCAGAAAAGTTTGCAGATCTATCAATC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GAATGCATTTTCATGATTGTTTTTGTCGAGTTGTGATGCTTCAATTCTTCTTGATGGACCTAGCACTGAGAAAACTGCTGTTCCTAATCTTCTTTTAAGAGGTTTTAATGTTATTGAAGA
TGCTAAAGCAAAGCTTGAGATGTTATGTCCTGGAGTTGTTTCGTGCGCTGATATTCTTACTCTTGCTGCTCGTGATTCTGTGGTTC
AGACTAGTGGCGTAAGTTGGAGAGTACCGATGGG
ACGTAGAGATGGGATCATTTCATTGGCATCCGAAACTACCAACTTGCCAGGATTTATTGACTCAGTTGATGTGCAAAAACAAAAATTTGCTGACAAGGGACTCAATATCCAAGATCTCGT
CACTCTTGT
AGGTGGACATACAATTGGTACTGCAGGATGTGCTGTAATTACGGGTAGATTATTTAATTTTAATGGAACAGCTGGAGCATCTGATCCTGCCATAAGCCCTTCATTCCTTCC
TACATTAAAAGCTCTTTGCCCTCAAAACGGTGATGCAAGAAAACGTGTAGCACTTGACACAGAGAGTGAAAATGAATTTGATACATCTTTCTTTAAAAACTTAAGAGATGGTAAAGGAGT
TATTCAATCTGATCAAGCACTATGGACTGATACCTCTACTAAAACCTTCGTTCAACGCTTTTTGGGTATTAGAGGCCTTCTTGGATTAACTTTCAATATCGAATTTGGAAAATCAATGGT
GAAAATGAGTAATATTGAAGTGAAAACAGGTACTGAAGGTGAAATCAGAAAAGTTTGCAGATCTATCAATC

Retrieve as FASTA