Entry information : SbPrx55 (Sobic.003G127100.1 [2.1] / Sb03g010740 [1.4])
Entry ID 879
Creation 2008-10-16 (Christophe Dunand)
Last sequence changes 2008-10-16 (Christophe Dunand)
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-08-04 (Messaoudi)
Peroxidase information: SbPrx55 (Sobic.003G127100.1 [2.1] / Sb03g010740 [1.4])
Name (synonym) SbPrx55 (Sobic.003G127100.1 [2.1] / Sb03g010740 [1.4])
Class Class III peroxidase    [Orthogroup: Prx014]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation N/D
Tissue types Callus
Roots
Seedlings
Inducers Acid treatment
Alkaline treatment
Dark growth
Repressor N/D
Best BLASTp hits
Perox score E-value SbPrx55
start..stop
S start..stop
SpPrx02 639 0 3..344 4..346
ZmPrx84 586 0 4..344 6..346
ZmPrx65 547 0 1..344 1..343
SiPrx11 538 0 32..344 36..347
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 11717418..11717699 282 N° 2 11718913..11719665 753  
join(11717418..11717699,11718913..11719665)


exon

Literature and cross-references SbPrx55 (Sobic.003G127100.1 [2.1] / Sb03g010740 [1.4])
Literature Cordonnier-Pratt,M.-M. et al., unpublished
DNA ref. Phytozome 11:   chromosome_3 (11717418..11719665)
Protein sequence: SbPrx55 (Sobic.003G127100.1 [2.1] / Sb03g010740 [1.4])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   344
PWM (Da):   %s   35822.03 Transmb domain:   %s   i21-43o
PI (pH):   %s   8.63
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRRQTAASGGRWRGGDGSVAAAWWVGVVVLGGHLLSCAQAGLLESNPGLAYNFYQKSCPSVDSIVRSVTWAQVAANPALPARLLRLHFHDCFVKGCDASILLDNAQSEKTAAPNLSVGGYEVIDAIKAQLEKACPGVVSCADILALAARDAVSYQFRSSLWQVETGRRDGTVSLASNTGTLPSPFAGFAGLLSSFANRGLNLTDLVALSGAHTIGVASCSSVTPRLYQGNATAVDPLLDSAYAKTLMSSCPNPSPAAATVGLDGGSPFKFDSGYYARVQQNQGTLASDAALAQNAAAAQMVADLTNPIKFYAAFSMSMKKMGRVEVLTGTNGQIRKQCRQVNTS*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 3, intron 1) and 17 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGAGGCAAACAGCGGCTTCCGGGGGACGGTGGCGAGGAGGCGACGGCAGCGTTGCTGCGGCGTGGTGGGTGGGCGTGGTGGTCCTGGGTGGCCATTTACTGAGCTGCGCGCAGGCG
GGGCTGCTGGAGTCCAACCCGGGGCTGGCCTACAACTTCTACCAGAAGAGCTGCCCCAGCGTGGACTCCATCGTCCGCAGCGTCACCTGGGCGCAGGTCGCCGCCAACCCCGCCCTCCCG
GCTCGCCTCCTCCGCCTCCACTTCCATGACTGCTTCGTCAAG
GTCCGTCCGTCCGTCCCGTCCCTCCTGCTCTTGCCCTCTCTCTCACTCTCTCAATCATATCATTCATTCATTTGTTCA
TTCACTCACTCACTCATGACTCGTCTAGTCCATCACCTCGCCTCCTCGATCAATCATGCGCGTCCTCAGGCCGGCGTCGGTGCGATAGGTTAGAGGATAGGATAGGATGCATAAATCATT
TCGCCTGTGCATTTACTCTTGTCGGCAGCAGTCGGCACGGCGCGCGTCCGGCTTCGCCTCCAGCAGATCGAAAACGCCTCGGCTTCTTCTTCTTCTTCTTCTTCCTCCTCCAGTCCAGTC
CAATAATCCCGCATCTCTAACCGCATTGACCGACCCGCAGCACCAGGCGAGATTCAGGCGCCGACCACGGCCAGCCGAACACAGCACAACCCTTCAACAACATTTTTGCATACAAGTACA
TGCATCTCCGCATATGGAGTGTGGCCGGTGCCGTTCGTACAGTAGCACTAGCATATCCGGATCCTGCACTGCACGGCAGCGGTTTTTTTTTTTTTTTTACCGCGGATGGGTTGGTACGCA
ATGCAGTGCACTGCCCCCTTTCCATCCCAGTTGCCAGTAGTTTTCCAATCCTTTTGGTGGCTCTCACTCAGCGCCAGCGGAGTGGGCACCCAGCGCACTTTTGTCGGTTTTTCACCGAGG
ACAAGCAAGAGCGCTACAGAACACCCTCTCGCCCTCTCCTCGTGTTCTGTTCTGACGCCGTATGCGTAAGCATTACGGCACACCCTGTTTCCGTTCCCGACTTCTTCACTCGCCGGCCGG
GTTGGCACGCACACACACAGGACGACGACGGGGGAAAAAATCACGTACGAGTACGAGCGCCGCGAGGGCCGAGGGGAGCAACGCGAATCTTGTCATTTTGCCCCCGGCCCCCGGCGCTCA
CATCACATGCCCTCGTCCGGATTCCGGTGCCGCGCGACAGCTATCAAGGCTGCCGCGCCTGCGCCCCCCGTACGGCGGTCGCCTTGGCCTGGCCCCGTGCCCCCGTGGCCCCATCCCCCA
ACCCCATTCCCGCGACATTTTCAAACCCCAGGCCCCGCCGCGCCGAGGGAGCTCGCATCATGCACGCATCGCGGCGTGCGTGCGTGCCGCGTCTTGTCCTTGTCGCGTCGCTCGCCACGC
GCATGCTGTTGTTTGAAACTGATGAAACCACCGGCTGCTTCTCATGGGTGTGCAGGGCTGCGACGCGTCGATCCTGCTGGACAACGCGCAGAGCGAGAAGACGGCGGCGCCGAACCTATC
CGTGGGCGGGTACGAGGTGATCGACGCCATCAAGGCGCAGCTCGAGAAGGCGTGCCCGGGCGTGGTCTCGTGCGCCGACATCCTCGCGCTGGCGGCGCGCGACGCCGTCTCGTACCAGTT
CAGGTCCTCGCTGTGGCAGGTGGAGACGGGCCGGCGGGACGGCACCGTGTCGCTGGCGTCCAACACGGGCACGCTGCCGTCGCCGTTCGCCGGGTTCGCGGGCCTGCTGTCGAGCTTCGC
CAACCGCGGGCTCAACCTGACGGACCTCGTCGCGCTGTCGGGCGCGCACACCATCGGCGTGGCCAGCTGCTCCAGCGTCACCCCGCGCCTGTACCAGGGGAACGCCACCGCCGTCGACCC
GCTCCTCGACTCCGCCTACGCCAAGACGCTCATGTCGTCGTGCCCCAACCCGTCCCCCGCCGCCGCCACCGTCGGCCTCGACGGCGGATCGCCGTTCAAGTTCGACAGCGGGTACTACGC
CAGGGTGCAGCAGAACCAGGGGACGCTGGCCTCCGACGCCGCGCTGGCGCAGAACGCCGCGGCGGCGCAGATGGTGGCCGACCTCACCAACCCCATCAAGTTCTACGCCGCCTTCTCCAT
GTCCATGAAGAAGATGGGACGCGTCGAGGTGCTCACCGGCACCAATGGACAGATCAGGAAGCAGTGCCGCCAGGTCAACACCTCCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGGAGGCAAACAGCGGCTTCCGGGGGACGGTGGCGAGGAGGCGACGGCAGCGTTGCTGCGGCGTGGTGGGTGGGCGTGGTGGTCCTGGGTGGCCATTTACTGAGCTGCGCGCAGGCG
GGGCTGCTGGAGTCCAACCCGGGGCTGGCCTACAACTTCTACCAGAAGAGCTGCCCCAGCGTGGACTCCATCGTCCGCAGCGTCACCTGGGCGCAGGTCGCCGCCAACCCCGCCCTCCCG
GCTCGCCTCCTCCGCCTCCACTTCCATGACTGCTTCGTCAAG
GGCTGCGACGCGTCGATCCTGCTGGACAACGCGCAGAGCGAGAAGACGGCGGCGCCGAACCTATCCGTGGGCGGGTAC
GAGGTGATCGACGCCATCAAGGCGCAGCTCGAGAAGGCGTGCCCGGGCGTGGTCTCGTGCGCCGACATCCTCGCGCTGGCGGCGCGCGACGCCGTCTCGTACCAGTTCAGGTCCTCGCTG
TGGCAGGTGGAGACGGGCCGGCGGGACGGCACCGTGTCGCTGGCGTCCAACACGGGCACGCTGCCGTCGCCGTTCGCCGGGTTCGCGGGCCTGCTGTCGAGCTTCGCCAACCGCGGGCTC
AACCTGACGGACCTCGTCGCGCTGTCGGGCGCGCACACCATCGGCGTGGCCAGCTGCTCCAGCGTCACCCCGCGCCTGTACCAGGGGAACGCCACCGCCGTCGACCCGCTCCTCGACTCC
GCCTACGCCAAGACGCTCATGTCGTCGTGCCCCAACCCGTCCCCCGCCGCCGCCACCGTCGGCCTCGACGGCGGATCGCCGTTCAAGTTCGACAGCGGGTACTACGCCAGGGTGCAGCAG
AACCAGGGGACGCTGGCCTCCGACGCCGCGCTGGCGCAGAACGCCGCGGCGGCGCAGATGGTGGCCGACCTCACCAACCCCATCAAGTTCTACGCCGCCTTCTCCATGTCCATGAAGAAG
ATGGGACGCGTCGAGGTGCTCACCGGCACCAATGGACAGATCAGGAAGCAGTGCCGCCAGGTCAACACCTCCTGA

Retrieve as FASTA