Entry information : CsaAPx02 (Cucsa.370590.5)
Entry ID 8796
Creation 2011-06-29 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: CsaAPx02 (Cucsa.370590.5)
Name (synonym) CsaAPx02 (Cucsa.370590.5)
Class Ascorbate peroxidase    [Orthogroup: APx003]
Taxonomy Eukaryota Viridiplantae Streptophyta Cucurbitaceae Cucumis
Organism Cucumis sativus    [TaxId: 3659 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CsaAPx02
start..stop
S start..stop
CkAPx03 523 0 1..286 1..286
LsaAPx02 517 0 1..286 1..285
HaAPx03 512 0 1..286 1..285
GhAPx01 511 0 1..286 1..288
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 282726..282838 113 N° 2 283185..283309 125 N° 3 283614..283663 50 N° 4 284644..284709 66
N° 5 284796..284844 49 N° 6 286035..286117 83 N° 7 286203..286282 80 N° 8 286378..286480 103
N° 9 287146..287337 192  
join(282726..282838,283185..283309,283614..283663,284644..284709,284796..284844, 286035..286117,286203..286282,286378..286480,287146..287337)


exon

Literature and cross-references CsaAPx02 (Cucsa.370590.5)
DNA ref. Phytozome 11:   scaffold03678 (282726..287337)
Protein sequence: CsaAPx02 (Cucsa.370590.5)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   287
PWM (Da):   %s   31417.34 Transmb domain:   %s   o257-279i
PI (pH):   %s   6.64
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MALPVVDTEYLKEIDKARRDLRALIANRNCAPIMLRLAWHDAGTYDVVTKIGGPNGSIRNEEEFSHGSNNGLKKAIDFCEEVKSKHPKITYADLYQLAGVVAVEVTGGPTIDFVPGRKDSNICPKEGRLPDAKKGAPHLRDIFYRMGLSDKDIVALSGGHTLGRAHPERSGFDGPWTEDPLKFDNSYFVELLKGEAEGLLKLPTDKALLEDPEFRQYVELYAKDEDAFFKDYAASHKKLSELGFTPGSAKAIVKDSIVLAQGAVGVAVAAAVVILSYLYEVRKKSK*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTGCCCGTCGTAGACACTGAATACCTCAAGGAGATCGACAAGGCTCGCCGTGACCTTCGCGCTCTCATTGCTAATCGGAATTGTGCTCCCATCATGCTTCGTTTGGCGTATGCT
CTCTTTACATTGACTTTCATTGACTATTTTCAATTATTATCACGAATACTCGTTTTATATCTCTTGGATTGTTATTTCATTTCTCTATCCACCTCGGTTGATTGAATGAAAATAGACGGA
CAGTTGACTTTTCTTCATTTAGTTTGTTGTTGTTGATTTCTGCTGTGTTTGTTTTTTTTTTTTGCTGGAATTGCATGGATGAGATTATTAGGAATTCTTTCATTTCGCTGTTTTTCTCAT
TTCTGTTGAATGAAGCTTTGCTTTCTCTTTGATTTTGATGATGGATGATTGTAGCAATTTTGTTTTCTAATGTTTCAAGCACTGTTCTGTCTTTTGTAGTTGGCATGACGCTGGCACTTA
CGATGTGGTTACGAAAATTGGTGGACCTAATGGATCGATTAGGAACGAGGAGGAGTTTTCTCATGGTTCTAATAATGGACTGAAAAAAGCTATTGATTTTTGTG
GTATGCTTTTTTTACT
CCTTTACTTTTTTCTTCTTTGCGTTGTGGGTCATGCAAACCGAAAGTCAACCTAATAATTTATCTGAGTAACGTTCCAAGTATCCCCACTGTTGTTAGATTCAAAATTACAATGGTGTCG
TTTCAAGATTTTTTCTTATTTATCGTCAATGTTCACTAAGTATTGCAAATTAACATATTTGACTTGCACTTCAAGTATAGGAAATTCTACAGTGTTTTTGTCTCTCCTAATGATTGTTGA
CAACTGATATTTCTTGATGTTGGTGATTGCTTCTTTCTTTAATAACAGAGGAAGTGAAGTCTAAACATCCGAAGATTACTTATGCAGACCTGTACCAGGTAATTGCAACTGTTATGGTAC
TATTGATATGCCTGCATTTTTGTAATTCTACGACGCTTGGTTTAACCTTATTTTATGTGGAATTGAATGGAATCTGCATTAAAGGAATCACATGCGTTTTAAATCTTAGCATGAGAAATA
TGTTTTTTTTATCAACAATATATAAATTGAGATTAGGTGAACAGGTCTACCGTTTTTGTTAATGGGGTTGTATATATGTTATAGAAGATTATGCTGCTTCAGCGTGTTTGAAGTTTGCTT
TTTTGTTAATCTTAACGTGAGAAATATGTTGTCATTGAAATTTTATTAGCATAGTTGTACGTACTGTGATTTTTTTTATTTCTTTATAGTGGAAAAGATGCATGCGTTCATATGCTATAT
GTGCCTAAGTTTGTATTTTAAGAATCAATTTTACATATACATTTTCATAACTCCTAGATAAAAGCTTGATAAAAAGTGCAAATTGTAATAGGAAGATTGTATAACACTGACAAAGTCGTT
GAATTAACTTTAAAAGTATAAATGTCATGTACTGTAATCAGTATTGTTGAATCTTTTTGGCAATGGTAAACTATTTTGTTATAAGTTGCATTCGGAGTTGGGGAGAAATTGGCCATAAAC
TCTGATCACATTTGCTCCCTATCTCACTCCAAAATAAAAATGGGATGCTATTTTCATATATTTGTTCCTATAGCCTCCCTGACCAAAAGGTGGTGCCTGTCATGGAGCAGTACCTAGTGA
CGATGTGAACTTTAGGCAAATGCAGATACTAGAGTTTCAGAAAATCACTTTTACCTGATCTTAGCATCNNNNNNNNNNNNNNNNNNNNNNNCCAAGGCATACTTAGAGATTGTTATCCAT
TACAATGCATCTACTATGGCAAGAACAATGAGATTATCAAGTTTTCTCAATTCATCAATGCTATAGAGCTTGTACAATTGACTAAGGTCTGATAGTGTTTAAAATGTACTCAATTCAGCT
AGCTGGCGTTGTTGCTGTTGAGGTCACTGGAGGCCCCACCATTGACTTTGTTCCCGGTAGAAAG
GTACAGTAATTTATTTGTTTACTTTGTGAATGTCAGCTGCTGGTTATATTATTTGT
TCCAGTAATAACTAAATCCTTTGTTCTCAGGATTCAAACATTTGTCCTAAGGAAGGCCGACTTCCTGATGCTAAAAAAGGTATAATAATTCCTTTATCATCTTGTACGTAGTTTCCTGCA
GTCCTGCAAAGTGAATGATATCTGAATATCTTCTCTGCATCTAGTGTGAATAAAACTATTATGGTTGAGTTTCGAGCTAACTGGTTTATTTTATTTTATAATCATTTGTCAAAGAGAGAA
AAGGAAGATCTGCAATTGTTTATCGTGTTTTAATTAGTTGCACAATTTTACATAAAATTGTGGCTCTTGTGTTTAAGATGAGAGTAAAGTAAGTCGTAGATGTTTGGTCGGCTTAGAGGT
TCTATATGGAATCGTAAGGTGCCAGTGCCGCAACCTAGAATTTGATTTAATCATGTTGATATTGTTAATACCATCGCAGTATATGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCCTATATGTTTTTCGACATGATAATTCATGTTTAGACTGCTTTTTAATAAAATATTTTGTCCTCGTTATTTGTACTTCACTG
GAAGTTGCTTCTTATTTTCTCCCGGGGTTTTATGATAAAGATACGTTCAAATTCTATAAGTTTTGTGCATTTTTGCTGTCGTGCTCAAGTTTTGTGCATTTTTGCTGTCGTGCTCAAGTT
TTGTTATGAAATTGTCACTTATCAAATTTGATTTCTTAAATGTTAGCCTTTTTCTAATTTTGGTAATAGGTGCACCGCATCTGCGTGACATTTTTTATAGGATGGGCCTGTCTGACAAGG
ATATTGTTGCATTATCCGGGGGTCACACTTTG
GTAATTTCTTCACACATCTTATTCTTGCATTGGTTTATTTTTGTATTACTAATTGAATCATATGTTGTGAATTCTGATGTTATAGGGA
AGAGCACATCCGGAGAGATCTGGTTTTGATGGACCCTGGACAGAGGATCCTTTGAAGTTTGATAACTCATACTTTGT
GTAGGACTTGAGCTACATCTCAGACTAATCCCTGTATCATTTT
AATAGGCCATGCATAATGTTATTTTTAATTGTTTGCAATTTGATGTTGATAGGGAACTGTTGAAAGGAGAAGCAGAGGGATTATTAAAACTTCCTACGGACAAGGCTTTACTTGAAGATC
CTGAGTTCCGCCAATATGTGGAATTGTATGCCAAA
GTAAGGTCTTTTATGCATTATGGAAAAGCGGGAAAATGTGCTAGTTTTCCATCATAAGAGGAAATTAAAAGTTCTGTAGTCTAAT
TAATTCAATCTTTAAATAAAGAATCGGCTTGGTTTGGACTTTGAAGTGACCTAAATAGAGGAACTAGTTAAAAGAATACCACCAATTAGAACTTTAGAACTGGCCGGTGTGATTAGTTTC
TCAGAAGGTCATGGGAGTGTGGATTTTTTTAGTACAACTGTGGGTAGGGGATTAGGTCACAGAATCGGTCACAGAATCGTGCCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATCATGTATTTGTTGAAAACTTGGTAGGCTATATGGGTCTTTAGAATTAATGATTATGATTATGGT
ACATTGTATCGGTCACATTTATGACATGACAGATTTTAAAGAAACGATCCAACAATTAAATGATAGTTCTAGTACTAATATAATTGATAACTGGAAATTAAGATCCATTTGAAATTTATG
CCATAGTTTAAGGAAGTAATGAATATGACTAAGCCATTCTTCTATTGAGTTACCATATATATTGAGTTATTTCTTATTATGTTTTTGCCAATTTGTACAGGATGAAGATGCATTCTTCAA
AGATTATGCTGCATCACACAAGAAACTTTCGGAGCTTGGGTTCACTCCAGGTTCTGCTAAGGCGATTGTGAAAGACAGCATCGTATTAGCACAGGGTGCTGTTGGAGTTGCGGTTGCAGC
TGCTGTGGTAATTCTGAGCTACTTATATGAAGTCCGCAAAAAATCGAAGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTGCCCGTCGTAGACACTGAATACCTCAAGGAGATCGACAAGGCTCGCCGTGACCTTCGCGCTCTCATTGCTAATCGGAATTGTGCTCCCATCATGCTTCGTTTGGCTTGGCAT
GACGCTGGCACTTACGATGTGGTTACGAAAATTGGTGGACCTAATGGATCGATTAGGAACGAGGAGGAGTTTTCTCATGGTTCTAATAATGGACTGAAAAAAGCTATTGATTTTTGTG
AG
GAAGTGAAGTCTAAACATCCGAAGATTACTTATGCAGACCTGTACCAG
CTAGCTGGCGTTGTTGCTGTTGAGGTCACTGGAGGCCCCACCATTGACTTTGTTCCCGGTAGAAAGGATTCA
AACATTTGTCCTAAGGAAGGCCGACTTCCTGATGCTAAAAAAG
GTGCACCGCATCTGCGTGACATTTTTTATAGGATGGGCCTGTCTGACAAGGATATTGTTGCATTATCCGGGGGTCAC
ACTTTG
GGAAGAGCACATCCGGAGAGATCTGGTTTTGATGGACCCTGGACAGAGGATCCTTTGAAGTTTGATAACTCATACTTTGTGGAACTGTTGAAAGGAGAAGCAGAGGGATTATTA
AAACTTCCTACGGACAAGGCTTTACTTGAAGATCCTGAGTTCCGCCAATATGTGGAATTGTATGCCAAA
GATGAAGATGCATTCTTCAAAGATTATGCTGCATCACACAAGAAACTTTCG
GAGCTTGGGTTCACTCCAGGTTCTGCTAAGGCGATTGTGAAAGACAGCATCGTATTAGCACAGGGTGCTGTTGGAGTTGCGGTTGCAGCTGCTGTGGTAATTCTGAGCTACTTATATGAA
GTCCGCAAAAAATCGAAGTAA

Retrieve as FASTA