Entry information : CsaAPx04 (Cucsa.051640.1)
Entry ID 8798
Creation 2011-06-29 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: CsaAPx04 (Cucsa.051640.1)
Name (synonym) CsaAPx04 (Cucsa.051640.1)
Class Ascorbate peroxidase    [Orthogroup: APx001]
Taxonomy Eukaryota Viridiplantae Streptophyta Cucurbitaceae Cucumis
Organism Cucumis sativus    [TaxId: 3659 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CsaAPx04
start..stop
S start..stop
EgrAPx03 427 5e-154 1..245 1..245
EcamAPx03 424 4e-153 1..245 1..245
ZaAPx03 419 7e-151 1..245 1..246
CmAPx01 419 9e-151 1..245 1..245
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 30243..30361 119 N° 2 29972..30146 175 N° 3 29765..29830 66 N° 4 29020..29068 49
N° 5 28563..28645 83 N° 6 28363..28442 80 N° 7 28155..28257 103 N° 8 26916..26978 63
complement(join(26916..26978,28155..28257,28363..28442,28563..28645,29020..29068 ,29765..29830,29972..30146,30243..30361))


exon

Literature and cross-references CsaAPx04 (Cucsa.051640.1)
DNA ref. Phytozome 12:   scaffold00560 (30361..26916)
Protein sequence: CsaAPx04 (Cucsa.051640.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   245
PWM (Da):   %s   27005.84  
PI (pH):   %s   6.35
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGKSYPTVSHEYQTAITKARRKIRALVAEKHCSPLMLRLAWHSAGTFDVKTRTGGPFGTMKNAAELAHEANRGLDIAVKLLEPIKEQVPILSYGDFYLAGVVAIEVTGGPEIPFHPGREDKPEPPPEGRLPDAAKGCDHLRDVFYSMGLSDQDIVALSGAHTGKAHKDRSGFEGPWTKNHLIFDNSYFKEILSDDKPELLKLPSDKALLTDPVFRPLVERYADEDAFFADYAEAHLKLSELG*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Incorrect prediction from phytozome (3' end is missing which has been completed).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGGAAAAGCTATCCGACTGTCAGCCACGAATACCAGACGGCTATCACAAAGGCGAGGAGGAAGATTAGAGCTCTTGTTGCTGAGAAGCACTGCTCTCCTCTAATGCTTCGTCTCGCG
TTGGTTTCTCTGTTCCGATTATGAATCCTTGATTTCATTATATTATGAATGAACGACGATATTTAATTTACTATGGAATGGATGTGTAATTTCAGATGGCACTCAGCCGGAACGTTTGAC
GTTAAGACTAGAACGGGAGGTCCGTTCGGCACAATGAAGAATGCAGCAGAGCTCGCTCACGAGGCTAACAGAGGCCTTGACATCGCCGTTAAGCTTTTGGAACCGATTAAAGAGCAGGTG
CCGATTCTTTCTTATGGTGACTTCTACCAG
GTACGGCACTATGATTCCGATCATTATTTTCGCACATTTCGTAAATGACTATTGCGAAAGTTTAAAATTATCGACGGATTAAAAAAATGA
ATCGAGTAATGTTTGTTTGTTATTCTTATTTTTATATTTGTTGTACAATAGCTCGCCGGAGTTGTTGCCATTGAAGTTACTGGTGGACCTGAGATTCCGTTCCATCCTGGCAGAGAGGTA
GTTTAGACGAAGTTGCTCCTCTCTACGTTTGTTTCGTGATTTCTTTTTGCCCTTTCGTTTTACGCTGTTTGCTACTGATCTTTGATGTCCGGATGGACAGTTCATTGTATACCTATGGAT
TCTCGATTTGCTAACATTATTTCGATCGTGAATTGCGTTTCAAACTCTTTTCTGATTATTTGCTCATACGTTTTTGATACTTGTCTCTTGCATAAGCATATCACCTATTGATTTTCTGTT
TGAAAGATTTATCTGAGCGGACATCGCTGAGAGCTCCCACTAGCCACTATTTTTACATTATTGGTGATTTTTTTTCCCAAAGAAAAGTGACTAATCAACAGATAGGTTAAATTATAAGAA
TGCCATAATTTTAGTTTGGACAAATAGTTTCAAAATGCCTTTAAGAAGTTTAAAAAATATTTTGGAAATAAAAGTACTCTAAAAAGAATTTTTACGCAATATCATGTAGGGACTATTTTT
TTTTATCATTTAACCTATTAGATTAGNNNNNNNNNNNNNNNNNNNNNNNNNNGTTGAATTTATAACTATCAGGTTAGTTTAATCATTAGTTCTATATGTGACTTGCTTGCGTTATTTAGT
TTTGTCTCAGAATTTATTCAAGTAGCATCTTTATTTTGTAATTCTCATATAACAACGCTGACCTGTATTATCCTTGGCGTTTTCTGTCATCAGGACAAGCCTGAGCCACCGCCTGAAGGC
CGTCTTCCAGATGCTGCTAAGG
GTGAGTACACATCATAGAAATAATTTAAGACAACTTCTCTTACGGTAATAATGAATTTATGTTGCACCCATATAATACTCAAATGGACTATCATTAAA
ACAACAGGGTTTTCAGAAAATAAATTAGTCTATCAATAACTAATTTTGTATTTAACATTTTTAAATTGTGAGATAAGAGATTGCACTACTAGAGTGCTGGAAATAAATTGCACTTGGACG
ATATTTATCAACATTCGATATTCAAACTACCAATATCATATCTTCGTTTCTAGACGTCTTACATTCAATCTCCTACGGGTTAAGTTTAAATTTTTGGTTGATCTATGATTTCACAGAAAT
GGTCTACATCTAAATCTAACATTTTTTTTTTTGTAGGATGTGATCATTTAAGGGATGTTTTCTACTCAATGGGTCTCAGTGACCAGGACATCGTTGCTCTTTCTGGTGCTCATACTCTGG
TTTGTTTCATTTGTGAATCTTTCCGCTTGCATCTTTCAATTATTCACCTCAATTTTTTTTAATTGACCTTTCCTATATGGGTTTTGACTCTTTCTTTTGAATTTTTATTTTATGCTTAGG
GAAAAGCCCACAAAGATCGATCTGGATTCGAAGGTCCGTGGACAAAAAATCATCTCATCTTCGACAACTCTTACTTCAA
GTGAGTTTTTTGCTTATAGACATCAATCTCCGTATATTAGA
GATTCCATTATTCTGTGAATTTATTTGTGTGTGTGTGTGNNNNNNNNNNNNNNNNNNNNNNNNGAGAGATCTTATCGGATGACAAGCCAGAGCTTCTTAAGTTGCCATCTGATAAGGCGC
TTCTGACTGATCCTGTCTTCCGTCCCCTAGTTGAGAGATATGCTGCG
GTATGAGTTTCTCATACTTGTTTTTTCTTTTCTTGCCAGCGAAGTTATCGAAACATCAAATTTCTTTACCCGG
ACAATTTAAAAAATATATTGTATACACACACAACAGTGACCCTAAACCCTTTTTCATTTTACATCTTTAACTTCAACCTTTTCATGAATTAAATTTAACATCCAAACTCAAATCCAAGGA
AATATAATTCTAAAGATCCCATCTAACTTAATATAATGAGTTTTGGTTAGGTCATGGTCATCTACCAAGACCTATAGGAAAAGCTTAAGTTTGATATGTTTAGGGTTTAGGGTTTTAGTA
TTTATCAATAATCAACCCTAAGCTTTATGCGTAGGTTACTTTTAAAAGGTAGAATACTTTGTCTCCGGAACAATTTAGTGGTTGAATTTTGGTCATTATACTTTAAAATTTATAATAATT
AGTCCATAAAATTTAATTATAGTTACTTAAAGTTTGTATAAGTTTAGTCATACCTAGCCGTGAAAATGGAGCAAGCCCAAGGTCAGAATCAAGAGCATGCCTTGGGTTTGGAGTTGTGGT
TGGAGGTCGAAGTGGAGGTAAATGAGAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNAGGGACCAAGCCATGACCCAAGAATGAGCCCAAGCCTAGGCCGAAGGACAAGATAAAAAACAAGAGAAAGGTGAAAGTGGAAGTTGGCAATGGTTTTTAGTCTTTAGTTTTAAAAAA
GCATTCCCAATAATATCTATCTCTACATAGATAAGATTAAAAAGGATCACTAAATCTTAATAATAGTCTTCAGAGTAAAGAACAGACCGGAAAATAGAGTAAATCAAATATGCTAAATTC
AGAAATGTTTACTTCTATAGGCAAGTTACAAGGATCTGATAGAGTGTCTTTAACCCAAATTTAATTAAATGGATATTTCAGTAAGATAGTTAGATGCATTATATAGTTTGTAGTAATCAT
GGTAATTCTTCCCCCTTTTGTAGGATGAGGATGCATTTTTTGCTGATTATGCGGAAGCACATTTGAAGCTCTCAGAGCTGGGGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGGAAAAGCTATCCGACTGTCAGCCACGAATACCAGACGGCTATCACAAAGGCGAGGAGGAAGATTAGAGCTCTTGTTGCTGAGAAGCACTGCTCTCCTCTAATGCTTCGTCTCGCA
TGGCACTCAGCCGGAACGTTTGACGTTAAGACTAGAACGGGAGGTCCGTTCGGCACAATGAAGAATGCAGCAGAGCTCGCTCACGAGGCTAACAGAGGCCTTGACATCGCCGTTAAGCTT
TTGGAACCGATTAAAGAGCAGGTGCCGATTCTTTCTTATGGTGACTTCTACCAG
CTCGCCGGAGTTGTTGCCATTGAAGTTACTGGTGGACCTGAGATTCCGTTCCATCCTGGCAGAGAG
GACAAGCCTGAGCCACCGCCTGAAGGCCGTCTTCCAGATGCTGCTAAGGGATGTGATCATTTAAGGGATGTTTTCTACTCAATGGGTCTCAGTGACCAGGACATCGTTGCTCTTTCTGGT
GCTCATACTCTG
GGAAAAGCCCACAAAGATCGATCTGGATTCGAAGGTCCGTGGACAAAAAATCATCTCATCTTCGACAACTCTTACTTCAAAGAGATCTTATCGGATGACAAGCCAGAG
CTTCTTAAGTTGCCATCTGATAAGGCGCTTCTGACTGATCCTGTCTTCCGTCCCCTAGTTGAGAGATATGCTGCG
GATGAGGATGCATTTTTTGCTGATTATGCGGAAGCACATTTGAAG
CTCTCAGAGCTGGGGTAA

Retrieve as FASTA