Entry information : AruPrx01-3 (HRPC1C / HRP1C / PeroxidaseC1C / HRPC3 / HRP_25148.1)
Entry ID 88
Creation 2006-09-05 (Christophe Dunand)
Last sequence changes 2014-06-12 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2014-06-12 (Christophe Dunand)
Peroxidase information: AruPrx01-3 (HRPC1C / HRP1C / PeroxidaseC1C / HRPC3 / HRP_25148.1)
Name (synonym) AruPrx01-3 (HRPC1C / HRP1C / PeroxidaseC1C / HRPC3 / HRP_25148.1)
Class Class III peroxidase    [Orthogroup: Prx035]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Armoracia
Organism Armoracia rusticana (horseradish)    [TaxId: 3704 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AruPrx01-3
start..stop
S start..stop
AruPrx01-2 676 0 1..352 1..351
BstrPrx03 665 0 3..352 4..353
BstrPrx51 651 0 14..352 16..354
AtPrx33 648 0 11..352 13..354
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 21..248 228 N° 2 1112..1303 192 N° 3 1836..2004 169 N° 4 2093..2562 470
join(21..248,1112..1303,1836..2004,2093..2562)


exon

Literature and cross-references AruPrx01-3 (HRPC1C / HRP1C / PeroxidaseC1C / HRPC3 / HRP_25148.1)
Literature REFERENCE 1 Fujiyama,K. et al Structure of the horseradish peroxidase isozyme C genes
Eur. J. Biochem. 173 (3), 681-687 (1988)
REFERENCE 2 Naatsaari,L., Krainer,F.W., Schubert,M., Glieder,A. and Thallinger,G.G. Peroxidase gene discovery from the horseradish transcriptome . BMC Genomics 15 (1), 227 (2014)
Protein ref. UniProtKB:   K7ZW56   K7ZWQ1   P15233 [Mismatch]
DNA ref. GenBank:   HE963802.1   HE963803.1 [Mismatch]
mRNA ref. GenBank:   M60729.1 [Mismatch]
Protein sequence: AruPrx01-3 (HRPC1C / HRP1C / PeroxidaseC1C / HRPC3 / HRP_25148.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   352 (323)
PWM (Da):   %s   38597.35 (35504.9)  
PI (pH):   %s   7.05 (6.88) Peptide Signal:   %s   cut: 30 range:30-352
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MHSPSSTSFTWATLITLGCLMLHASFSNAQLTPTFYDNSCPNVSNIVRDIIINELRSDPRIAASILRLHFHDCFVNGCDASILLDNTTSFRTEKDAFGNANSARGFPVVDRIKAAVERACPRTVSCADVLTIAAQQSVNLAGGPSWRVPLGRRDSRQAFLDLANANLPAPSFTLPELKAAFANVGLNRPSDLVALSGGHTFGKNQCRFIMDRLYNFSNTGLPDPTLNTTYLQTLRQQCPRNGNQSVLVDFDLRTPTVFDNKYYVNLKEQKGLIQSDQELFSSPNATDTIPLVRSYADGTQTFFNAFVEAMNRMGNITPLTGTQGEIRLNCRVVNSNSLLHDIVEVVDFVSSM

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATTCCCCTTCTTCTACTTCGTTTACTTGGGCAACCTTAATCACATTGGGATGTCTTATGCTTCATGCATCTTTTTCCAATGCTCAACTTACCCCTACCTTCTACGACAATTCATGT
CCTAACGTCTCAAACATAGTACGGGACATCATTATCAATGAGTTACGATCGGACCCTCGTATCGCCGCGAGCATCCTTCGTCTTCACTTCCACGACTGCTTTGTTAAT
GTAAGATATTAC
TTTTCATATTTCTATTGCGTTGTGAATTATTGTGTTTTATCTTTTTTTGAAGATATGTGTTTTATCTTTTAGATATTGATATATCACACCTCTAGTCAAAATTTAATAAAACATAAAATA
AAATATAATACAAAGAGGAGTATAATTAATAAAAAATTTAACATGTTTTTAATCTGGCTCAAAAATGTCGAAACGAGATTTCTTATGAAAAAGAGTAAGTATGTATTAAATCATAATTTG
CTACAATTATTGGGTGGTAAAAGTAAGGAATTCTATTCATTTTGAAATTTAGCTGGTTGCATAGCTTTATTCTACAACATTTTTACTGGATTCATTTTATAAAGTTATAATTTCACCTTT
TTTTTTTGTTAAATAGTTATAATTTCACTTGCCTTCGGAAAATATGTATAGCCTTACTATAACATAATTACATTCAATAATAATTTTTATTTTATTTATATAAAAAGATTATATTATTTT
TTGTTTTGTTCAGTTAGAGTGAACCGTATCCTAAATAAAAGTCACTCGAGTAACGGGTCTGATCCAGACAAAAAAAAAAAATTCAATACCAAATTTCACATGGTTAGATGTCGTATGTTT
AATTTTGCTGGTGAATAATTAATACTTAACTCTCGTCGACAATGATAATGCCAAAACATTTATGAAATCGGATTCATGAATTGTCCGTGTTACAGTATTAAGAGCATGGTGCCGTACCCC
AAACACGATATGAATTTAATGGATGACAAAAAAAAAATTCATTGTTAAATTGTTACCGGTGGTAAAGATTTAGCTATGGATGTAATACATTTACTAATAATTTGTTAATTAATATTTTGG
ATTTTTGATAGGGTTGTGACGCATCGATCTTGTTAGACAACACAACATCATTTCGAACAGAGAAAGATGCGTTTGGAAACGCAAACTCGGCTCGAGGATTTCCTGTGGTTGACAGAATCA
AGGCCGCGGTGGAGAGGGCATGCCCAAGAACTGTTTCATGCGCAGATGTGCTTACCATTGCAGCTCAACAATCTGTTAATTTG
GTATGTTCCAATAACTTCTGTCATTACAAACATTGTT
TTTAATTTTTTTTTTTTTTTGTTAAAATCATTGTTTTAAATTTTAATATATCAATTCCTCACTTTTACATATATCAAACGTACAACGATAGCCTAAGTTTGAAAAGAAAAGTATTCAAAA
CGTCACAATCTATATATTTAGCATCAACAACTTTTCAACTATATATATGAGGTATGTATGGATTAATCTAGAAATATTCAAAACGCGTGGTCGCGTTATTTGACAAGTTTAATAATATCA
TTGAAAAAGTAGGTATCATCACAAGAATTTACCTTGTAATAGGCAAAGCCTACCTTTATAGTTAACCAAAAAGAATAATTTTCATTTTTTTCCAAAAATTAGTGGAGATAAAACAAAGCT
CCACTACTTTGAGTATATATTATCAATCAATTTATACTACTTGTTTATCTTTTTCTCTTTACATATTGAAACTTCCGAGTGACAAAATTAATCTCAAAAAAAATAATTATTTTGAATATA
ATGGTTATTATATAGGCAGGAGGTCCTTCTTGGAGGGTTCCTTTGGGAAGAAGAGACAGCCGACAAGCATTTTTAGATCTCGCTAATGCGAATCTTCCAGCTCCATCCTTCACACTTCCA
GAACTTAAGGCTGCTTTTGCAAATGTTGGCCTCAACCGTCCTTCTGATCTCGTTGCTCTCTCTG
GTAATTAACAAAAGAAAACTAAACACCATTTGGTATAGTTTAATGAGCGATTTCAT
TATTAATCTTATTATGGTCTTTCTTTTGTTAGGTGGTCACACATTTGGTAAAAATCAATGTCGATTTATTATGGACAGATTATACAACTTCAGCAACACCGGACTACCCGACCCTACCCT
CAACACTACTTACCTTCAAACTCTTCGTCAACAATGTCCCCGTAATGGTAACCAAAGCGTCTTGGTGGATTTCGATCTGCGTACGCCAACAGTTTTCGATAACAAATACTATGTGAATCT
TAAAGAGCAAAAAGGTCTCATCCAGAGTGACCAAGAGTTGTTCTCTAGCCCCAATGCCACTGACACAATCCCCTTGGTGAGATCATATGCTGATGGCACACAAACATTCTTCAATGCCTT
TGTGGAGGCCATGAATAGGATGGGAAACATTACACCTCTTACAGGAACTCAAGGAGAAATCAGGTTGAACTGTAGGGTGGTGAACTCCAACTCTCTACTCCATGATATAGTGGAGGTCGT
TGACTTTGTTAGCTCTATGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATTCCCCTTCTTCTACTTCGTTTACTTGGGCAACCTTAATCACATTGGGATGTCTTATGCTTCATGCATCTTTTTCCAATGCTCAACTTACCCCTACCTTCTACGACAATTCATGT
CCTAACGTCTCAAACATAGTACGGGACATCATTATCAATGAGTTACGATCGGACCCTCGTATCGCCGCGAGCATCCTTCGTCTTCACTTCCACGACTGCTTTGTTAAT
GGTTGTGACGCA
TCGATCTTGTTAGACAACACAACATCATTTCGAACAGAGAAAGATGCGTTTGGAAACGCAAACTCGGCTCGAGGATTTCCTGTGGTTGACAGAATCAAGGCCGCGGTGGAGAGGGCATGC
CCAAGAACTGTTTCATGCGCAGATGTGCTTACCATTGCAGCTCAACAATCTGTTAATTTG
GCAGGAGGTCCTTCTTGGAGGGTTCCTTTGGGAAGAAGAGACAGCCGACAAGCATTTTTA
GATCTCGCTAATGCGAATCTTCCAGCTCCATCCTTCACACTTCCAGAACTTAAGGCTGCTTTTGCAAATGTTGGCCTCAACCGTCCTTCTGATCTCGTTGCTCTCTCTG
GTGGTCACACA
TTTGGTAAAAATCAATGTCGATTTATTATGGACAGATTATACAACTTCAGCAACACCGGACTACCCGACCCTACCCTCAACACTACTTACCTTCAAACTCTTCGTCAACAATGTCCCCGT
AATGGTAACCAAAGCGTCTTGGTGGATTTCGATCTGCGTACGCCAACAGTTTTCGATAACAAATACTATGTGAATCTTAAAGAGCAAAAAGGTCTCATCCAGAGTGACCAAGAGTTGTTC
TCTAGCCCCAATGCCACTGACACAATCCCCTTGGTGAGATCATATGCTGATGGCACACAAACATTCTTCAATGCCTTTGTGGAGGCCATGAATAGGATGGGAAACATTACACCTCTTACA
GGAACTCAAGGAGAAATCAGGTTGAACTGTAGGGTGGTGAACTCCAACTCTCTACTCCATGATATAGTGGAGGTCGTTGACTTTGTTAGCTCTATGTGA

Retrieve as FASTA