Entry information : CclAPx01 (clementine0.9_015164m)
Entry ID 8804
Creation 2011-06-25 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-05 (Qiang Li)
Peroxidase information: CclAPx01 (clementine0.9_015164m)
Name (synonym) CclAPx01 (clementine0.9_015164m)
Class Ascorbate peroxidase    [Orthogroup: APx004]
Taxonomy Eukaryota Viridiplantae Streptophyta Rutaceae Citrus
Organism Citrus clementina    [TaxId: 85681 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CclAPx01
start..stop
S start..stop
VvAPx07 585 0 1..349 1..344
PtAPx10 577 0 1..349 1..347
CpapAPx06 566 0 1..349 4..347
PpeAPx05 559 0 1..349 1..349
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 11622631..11622735 105 N° 2 11622806..11622904 99 N° 3 11623173..11623254 82 N° 4 11623337..11623371 35
N° 5 11623489..11623554 66 N° 6 11623666..11623706 41 N° 7 11624134..11624264 131 N° 8 11624390..11624496 107
N° 9 11625096..11625233 138 N° 10 11625781..11625915 135 N° 11 11626065..11626175 111  
join(11622631..11622735,11622806..11622904,11623173..11623254,11623337..11623371 ,11623489..11623554,11623666..11623706,11624134..11624264,11624390..11624496,116 25096..11625233,11625781..11625915,11626065..11626175)


exon

Literature and cross-references CclAPx01 (clementine0.9_015164m)
DNA ref. Phytozome 12:   scaffold_1 (11622631..11626175)
Protein sequence: CclAPx01 (clementine0.9_015164m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   349
PWM (Da):   %s   37906.32  
PI (pH):   %s   7.91
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGASFLSTVPSMLPIVPSPSRNAFSTVATRCSAHAGAIRCHKIETQITVEDGFGRRDILKCIGATIGMEIISGSGSIEMARAADLIQRRQRSEFISNIKETLQTALGNPDLIPSLLTLALNDAMTYDKATKSGGPNGSIRFSSEISRPENKGLSAAMNLLEEAKKEIDSYSKGGPISFADLIQYAQSAVKTTFLASAIRKCGGNEEKGRLLYTAYGSNGQWGLFEKQFGRTDAQEPDPEGRVPQWEKATVQEMKDKFSAIGFGPRLAVMSAFLGPDQAATEALLATDKDVSPWVQKYQRSRETVSQTDYEVDLITTFTKLSSLGQQINYEAYTYPAQKIELGKLKL*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Incorrect prediction from phytozome (Short PS is missing).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGCGCTTCTTTTCTCTCTACGGTTCCTTCTATGCTTCCCATTGTTCCTTCCCCATCGCGCAACGCTTTCTCTACTGTTGCCACCAGATGCTCCGCTCATGCTGTAAGCTTGCTGCAG
TGTTCATATTGATATGGCTTATTTATAACTTCACTGAATTATGTTCAACGTCCAGGGTGCTATACGTTGTCATAAAATTGAGACTCAAATAACTGTTGAAGATGGTTTTGGTAGAAGGGA
TATTCTGAAATGCATTGGTGCGACCATTGGCATG
GTGAGAACCATCCCTTTCTTCTATTTATCTTTATATCTAATGCATGAATTATATGTAGCACTAGTTTTTTTGTTCCTTGCATCAAT
CGCAAATTGGAGGAAGCATCTCCTCTTAATTTTTGGCCAGCGCTTGACTAAGAAGACTCTTTTGCCAAATTTAAATCGAATTTGTTCTGTCGGATAAACAACGTAGAATCTCTGTTAGGG
TCTGGAACCACAAATAAGAATGATTTGATGATGAGTTTCTGCCAGTTGTGGTCTCTTCTTAGGAAATAATATCAGGCTCAGGATCAATTGAAATGGCACGTGCTGCTGATTTGATACAAC
GCAGACAGCGTTCGGAGTTTATTT
GTAAGTTCCATATACACATCTTCATTGTGCTTAAACTAGCAGGAACTGCTGAATTAACAGCTTACATCCTTTTCTTACCCAGCCAATATCAAGGAG
ACTCTCCAAACTGCTCTCAAG
GTATGCATATTCCAAGTTCTTCTGCTATATGAATATCAGGACATCGTATGTAGAAGTAAATTAGGCTAACTATGTTATCAATGTGCATCAACACTTCTT
TCAATGTACCTGTTTCAGGGAAATCCAGATCTTATCCCATCTCTACTAACTTTGGCACTCAATGATGCCATGACTTATGATAAGGTCAGGACAAAGCCTCTAAGATTTAAGTGCCTTGTA
GATGTCATAAAATTCCTTTACTTGTTATGGAGAAAGGAAGGAAATAAGCTGATGTCTTGCTGGTTAAGTTTGTAGGCTACAAAATCTGGAGGCCCTAATGGATCCATAAGGTTCAGGTAC
TTGCTACATGAAGCATTATCTCAGAAATAATTTTGACCTGAAATTTCACACTTCTTGAAATGAGTATGGAATAATGTATGCACATTGGAAAAATCATAGTCAAATCTTTATGATATTCTT
CTGAAGATACAGAAATCTATGCTTTTCCCAGATGTCAGTTTATTAAAAATCGTTTTTTGGCATTTCAAATACCAATAATTAGTTACTGTTGTTTGATCATTGTTTCCAGCATCTTACAGA
AACATTTGGATAGGAAGAATGGAAGTTATGCTTGCCTGATTTACCAAATACGATAATATATATTTCATGAATTTTCTGTTGCTTTAGCAATCGAACTTTCCCTTTTCCTGTGATTATGCA
TCAGTAATTTTGGCTTGGTAAAAAGTTGCCTTGTTTTTCTTCTGCTGGTTTTGTTGGCTGAAGCTCAGAGATAAGCAGACCAGAAAATAAGGGGCTTTCTGCTGCCATGAATTTGTTAGA
GGAAGCAAAGAAGGAGATAGATTCATATTCTAAAGGTGGACCAATATCCTTTGCCGATCTCATCCAGTATGCAG
GTTACAATATTAGAAATGCCAAGTTTGAGCGCTGTAGCGTGTTAAG
ACTGTCTACTATGAATTTCTTTGGGAGTCCACAGAGAGAAGCATAGAGTGCCCAACTCAATTTTCTTCGCTTTTTGCAGCACAAAGTGCCGTTAAGACAACATTTTTGGCATCAGCCATC
CGCAAATGTGGAGGGAATGAAGAGAAAGGGCGCTTATTGTACACTGCATATGGCTCAAATGGTCAG
GTTTGTTTCTCAGTATGCTAGGCTTCTTGTGGTATGTTTAAATCACGTGCATAG
CTTGTTAACCACAATCAGTTAACTTTGACATACCATCATAAATTTTTCTTCCAAGTCTGTAAATGTAATCACTAAATGCAATTTTCTGACCTTTGACTGGGATGTATTAAACACTTTGGC
AATTTTCCTAAACACCTAATGGTGAAATTGCTTAAATTATTTTCTGTTTCTCCGTTTATGCTGTGCGGTTGCTTCGTCGGGCCATTTATTATAAAGCATTAAGTTCTCCTTTCATCTTTT
GAATCATAAAGGTCTACATATGCAAGCTATACCTATAGAGAAAATTAGTTGTACAATCACCACGATGCTTTTAGGAGGGAACTTAAAATCCTGTAATGGCCACCTTGAGAGAAGTAATTA
AGGGAACTTAAAAATCCTAAAATGGACATCTTGGGAGAAGAAGGAAGGTAAACCATGGTAACAGTGTGTATGACCTGAATGAGTTGTGAATGCCTGTATTTCTGCTGGCATAGATCTTTA
TGGCACTCTAGCTTTCTCTGAGAGGAACTTATGGATGATGCATAAAATTGTTCTTCTATCAACAGTGGGGCCTGTTTGAAAAGCAATTTGGAAGGACAGATGCTCAGGAGCCAGATCCAG
AGGGAAGGGTTCCCCAGTGGGAGAAAGCTACTGTCCAGGAAATGAAAGATAAATTCTCAGCAATTGGCTTTGGTCCCCGCCAG
GTATTTTCTCTATCGTACTTGCTGTCATAATTGCTCT
TCTTCTGTCTTATATCATCATTAAATTGCTGAGGCAAGCTTCGAGAATCCCTTTGGTCAAATGTATACCTGTCATATTACACTTTGGTTAAAATCAAGACTCATTTGAACAATGTAGTAG
TCTGGCTTATGAAAAATTTTCCTACTACACTCTGTTGTTTGACTCAAAACTACAACAAAAGTCATCAGAATATTTGTTTATATTCAATATGTTAGTTCAGGCCACTAATGCAACTCCTGT
TATTCAATAAATTTATACAAATTACTTCGCTTGCCGATATAGTCAATCAAATGGTCGTCTCTGGCATTGAGATATCCGATTTTACATTTGATACTATTTAAATGTCTTACTACATGTTAA
GCCTGCAGTAACATTGATAATGGGTGTGTGGAGGAAAATCCTTAACTACAGTATGACCATCTAGAGGGAACTCCTGCATTCTTTCTTTTAATGCTGTCGTGATTAATACTCATGGATCTG
GGTCTTTTCAAATCCTTTGTTGGTCGGCAGCTAGCTGTTATGTCTGCGTTCTTGGGTCCTGATCAGGCAGCAACAGAAGCCTTATTGGCCACCGATAAAGATGTTTCTCCTTGGGTTCAG
AAATACCAACGTAGCAGAGAAACAGTGTCTCAGACTGATTATGAG
GTTAGATTTTTTCATCCCCATTCCATTTTTTAGAAGAACTCAGGGCCATTAAGAAGGCCAACCTTGTGTTTGTTT
AGTTTTATATAGAAAATTAAATCATGATGCATTTTAATTCCTAGGCTCAGTTTTCAAGTTTGATTCTTTGACAGGTCGATCTGATAACTACATTCACGAAATTAAGTAGCCTGGGCCAAC
AAATCAATTACGAGGCTTACACATATCCTGCTCAAAAGATTGAATTGGGCAAACTCAAATTGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGCGCTTCTTTTCTCTCTACGGTTCCTTCTATGCTTCCCATTGTTCCTTCCCCATCGCGCAACGCTTTCTCTACTGTTGCCACCAGATGCTCCGCTCATGCTGGTGCTATACGTTGT
CATAAAATTGAGACTCAAATAACTGTTGAAGATGGTTTTGGTAGAAGGGATATTCTGAAATGCATTGGTGCGACCATTGGCATG
GAAATAATATCAGGCTCAGGATCAATTGAAATGGCA
CGTGCTGCTGATTTGATACAACGCAGACAGCGTTCGGAGTTTATTT
CCAATATCAAGGAGACTCTCCAAACTGCTCTCAAGGGAAATCCAGATCTTATCCCATCTCTACTAACTTTGGCA
CTCAATGATGCCATGACTTATGATAAG
GCTACAAAATCTGGAGGCCCTAATGGATCCATAAGGTTCAGCTCAGAGATAAGCAGACCAGAAAATAAGGGGCTTTCTGCTGCCATGAATTTG
TTAGAGGAAGCAAAGAAGGAGATAGATTCATATTCTAAAGGTGGACCAATATCCTTTGCCGATCTCATCCAGTATGCAG
CACAAAGTGCCGTTAAGACAACATTTTTGGCATCAGCCATC
CGCAAATGTGGAGGGAATGAAGAGAAAGGGCGCTTATTGTACACTGCATATGGCTCAAATGGTCAG
TGGGGCCTGTTTGAAAAGCAATTTGGAAGGACAGATGCTCAGGAGCCAGATCCA
GAGGGAAGGGTTCCCCAGTGGGAGAAAGCTACTGTCCAGGAAATGAAAGATAAATTCTCAGCAATTGGCTTTGGTCCCCGCCAG
CTAGCTGTTATGTCTGCGTTCTTGGGTCCTGATCAG
GCAGCAACAGAAGCCTTATTGGCCACCGATAAAGATGTTTCTCCTTGGGTTCAGAAATACCAACGTAGCAGAGAAACAGTGTCTCAGACTGATTATGAG
GTCGATCTGATAACTACATTC
ACGAAATTAAGTAGCCTGGGCCAACAAATCAATTACGAGGCTTACACATATCCTGCTCAAAAGATTGAATTGGGCAAACTCAAATTGTAG

Retrieve as FASTA