Entry information : CsaPrx23 (Cucsa.085830.1)
Entry ID 8813
Creation 2011-06-29 (Qiang Li)
Last sequence changes 2011-12-07 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-01-11 (Christophe Dunand)
Peroxidase information: CsaPrx23 (Cucsa.085830.1)
Name (synonym) CsaPrx23 (Cucsa.085830.1)
Class Class III peroxidase    [Orthogroup: Prx002]
Taxonomy Eukaryota Viridiplantae Streptophyta Cucurbitaceae Cucumis
Organism Cucumis sativus    [TaxId: 3659 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CsaPrx23
start..stop
S start..stop
PtrePrx01 621 0 1..331 1..331
PtremPrx01 621 0 1..331 1..331
PtPrx02 620 0 1..331 1..331
PbPrx03 620 0 1..331 1..331
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 208922..209152 231 N° 2 209248..209436 189 N° 3 209567..209732 166 N° 4 210026..210432 407
join(208922..209152,209248..209436,209567..209732,210026..210432)


exon

Literature and cross-references CsaPrx23 (Cucsa.085830.1)
DNA ref. Phytozome 12:   scaffold00870 (208922..210432)
Protein sequence: CsaPrx23 (Cucsa.085830.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   331 (307)
PWM (Da):   %s   37525.19 (34835.8) Transmb domain:   %s   i5-24o
PI (pH):   %s   8.31 (8.01) Peptide Signal:   %s   cut: 25 range:25-331
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGSKALCVFFFLFFVAVSFRYASAQDEEDNGLVMNFYKDTCPQAEDIIKEQVRLLYKRHKNTAFSWLRNIFHDCAVQSCDASLLLDSTRRTLSEKETDRSFGLRNFRYIETIKEAVERECPGVVSCADILVLSARDGIVSLGGPYIPLKTGRRDGRKSRADILEEYLPDHNESMSVVLERFGAMGIDTSGVVALLGAHSVGRTHCVKLVHRLYPEVDPVLNPGHVEHMLYKCPDEIPDPKAVQYVRNDRGTPMILDNNYYRNILDNKGLLIVDHQLATDKRTKPYVKKMAKKQDYFFKEFSRAITILSENNPLTGTKGEIRKQCNVANKL

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTTCCAAAGCACTGTGTGTTTTCTTCTTTCTTTTCTTTGTGGCTGTTTCTTTCAGGTATGCTTCAGCACAGGATGAGGAAGACAATGGTCTTGTCATGAATTTTTACAAAGATACA
TGTCCCCAAGCTGAAGATATCATCAAAGAACAAGTTAGGCTTCTCTACAAGCGCCATAAGAACACTGCATTCTCTTGGCTCAGAAACATTTTCCATGACTGTGCTGTTCAA
GTAATCTCT
TCTCTTTCCATATCCTTTTAATTCTTCCATGGGTTTCAATTTTTCCTGCTGAATTTCTTTTGCTAACATAAAAATGACGATATCAGTCCTGTGATGCCTCTCTGCTGCTGGATTCAACAA
GAAGAACCCTTTCAGAGAAGGAAACAGACAGAAGCTTTGGACTTAGGAACTTCCGGTATATTGAGACCATTAAAGAGGCGGTGGAAAGAGAATGCCCTGGAGTTGTCTCCTGTGCAGATA
TCCTTGTTCTGTCAGCCAGAGATGGCATTGTTTCT
GTAAGTACATTTCTTTCTTCTTTTTTCCATTCTCTGTTTTGCTTTTGCCCAAAACTAGTAAGGATTCCTCCCCTTGTCTGATTTT
GATAAGAAGCTGTTGGCTTGGCTTTAACTCTGCCTTTTTGTGCAGCTTGGGGGACCTTATATCCCACTTAAAACAGGCAGAAGAGATGGAAGGAAAAGCAGAGCTGATATTTTGGAAGAG
TATCTTCCAGACCACAATGAAAGCATGTCTGTGGTTCTTGAAAGATTTGGTGCCATGGGTATTGACACCTCTGGAGTGGTTGCTTTACTAG
GTAGACATACCTAAACTTAGCTGAAACTT
TTGGGTTCTCAGTAGCCAAACATCTTATAAAGTTGTTCCTTCCCCATCTTTTTAGTTCAACATGTGGAGGTTTGGGAAAGTTTTTAGTAGCCAAACAGCTGAAGCTTTCAGTCACTTTTG
AGACTTGAGTTTTAACACTTTTACAAAGTTTCTTTCTGAATTTGAGCACTAAACTTGTTTAAAGTTCCATGCAGATGTCTGGATCTCCTAAATCTTTTGAATTGGAGAAAACTTAATTAG
ATCTGAACCCTCTGTGTTCTGCAGGAGCTCATAGTGTTGGTAGAACACACTGTGTGAAGCTGGTGCACCGGCTGTACCCAGAAGTAGACCCTGTGCTGAACCCTGGCCATGTAGAGCACA
TGTTGTACAAGTGTCCTGATGAGATCCCAGACCCCAAGGCTGTACAGTACGTGAGAAATGATCGTGGTACACCTATGATTCTGGACAACAACTACTATAGAAACATACTTGACAACAAGG
GACTGCTGATTGTGGATCACCAACTAGCCACAGACAAGAGAACAAAGCCATATGTGAAGAAAATGGCCAAAAAGCAAGACTATTTCTTCAAGGAATTCTCAAGAGCCATTACCATCCTTT
CTGAGAACAACCCTCTCACTGGCACAAAGGGTGAAATCAGGAAGCAGTGTAATGTTGCCAACAAGCTGCAC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTTCCAAAGCACTGTGTGTTTTCTTCTTTCTTTTCTTTGTGGCTGTTTCTTTCAGGTATGCTTCAGCACAGGATGAGGAAGACAATGGTCTTGTCATGAATTTTTACAAAGATACA
TGTCCCCAAGCTGAAGATATCATCAAAGAACAAGTTAGGCTTCTCTACAAGCGCCATAAGAACACTGCATTCTCTTGGCTCAGAAACATTTTCCATGACTGTGCTGTTCAA
TCCTGTGAT
GCCTCTCTGCTGCTGGATTCAACAAGAAGAACCCTTTCAGAGAAGGAAACAGACAGAAGCTTTGGACTTAGGAACTTCCGGTATATTGAGACCATTAAAGAGGCGGTGGAAAGAGAATGC
CCTGGAGTTGTCTCCTGTGCAGATATCCTTGTTCTGTCAGCCAGAGATGGCATTGTTTCT
CTTGGGGGACCTTATATCCCACTTAAAACAGGCAGAAGAGATGGAAGGAAAAGCAGAGCT
GATATTTTGGAAGAGTATCTTCCAGACCACAATGAAAGCATGTCTGTGGTTCTTGAAAGATTTGGTGCCATGGGTATTGACACCTCTGGAGTGGTTGCTTTACTAG
GAGCTCATAGTGTT
GGTAGAACACACTGTGTGAAGCTGGTGCACCGGCTGTACCCAGAAGTAGACCCTGTGCTGAACCCTGGCCATGTAGAGCACATGTTGTACAAGTGTCCTGATGAGATCCCAGACCCCAAG
GCTGTACAGTACGTGAGAAATGATCGTGGTACACCTATGATTCTGGACAACAACTACTATAGAAACATACTTGACAACAAGGGACTGCTGATTGTGGATCACCAACTAGCCACAGACAAG
AGAACAAAGCCATATGTGAAGAAAATGGCCAAAAAGCAAGACTATTTCTTCAAGGAATTCTCAAGAGCCATTACCATCCTTTCTGAGAACAACCCTCTCACTGGCACAAAGGGTGAAATC
AGGAAGCAGTGTAATGTTGCCAACAAGCTGCAC

Retrieve as FASTA