Entry information : CsaPrx36 ( Cucsa.127000.1)
Entry ID 8823
Creation 2011-06-29 (Qiang Li)
Last sequence changes 2011-12-07 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-01-27 (Christophe Dunand)
Peroxidase information: CsaPrx36 ( Cucsa.127000.1)
Name (synonym) CsaPrx36 ( Cucsa.127000.1)
Class Class III peroxidase    [Orthogroup: Prx029]
Taxonomy Eukaryota Viridiplantae Streptophyta Cucurbitaceae Cucumis
Organism Cucumis sativus    [TaxId: 3659 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CsaPrx36
start..stop
S start..stop
CsPrx13 535 0 5..345 17..354
CppPrx08 531 0 7..345 18..353
CclPrx92 527 0 7..345 20..355
VvPrx53 527 0 17..347 26..347
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 805342..805602 261 N° 2 805021..805221 201 N° 3 802860..803438 579  
complement(join(802860..803438,805021..805221,805342..805602))


exon

Literature and cross-references CsaPrx36 ( Cucsa.127000.1)
DNA ref. Phytozome 12:   scaffold01017 (805602..802860)
Protein sequence: CsaPrx36 ( Cucsa.127000.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   347 (321)
PWM (Da):   %s   37839.49 (35016.0)  
PI (pH):   %s   9.57 (9.70) Peptide Signal:   %s   cut: 27 range:27-347
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPVPFSLLCFLTLLLISYTPSKCANAKPPPPKQAPARRHRLLSVDYYNKTCPHLDQLVSSITTQQFKDAPVSAPATLRLFFHDCFVEGCDGSILISTKPGSKVAAEKDAVDNKGLRPEAFESIKKAKALVESKCPGVVSCADILAIAARDFVHLAGGPYYPVKKGRWDGKISMASRIGSNLPRANSTVDQLLKLFNSKGLSADDLVVLSGAHTIGFAHCEHFTNRLYDYRGTKQPDPAIDGRLLKELKMSCPRYGGNTDIVAPFDVTTPFVFDHAYYGNLEGKLGLLATDQGLVSDARMKTMVQGLAKDKQKFFQAFAAAMDKMGSIGVKRGRRHGERRTDCSIHQS

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 1 and 2).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTGTCCCTTTTTCTCTTCTCTGTTTTCTCACTCTGCTTCTCATTTCCTACACACCATCAAAATGTGCCAATGCAAAACCACCACCACCTAAACAAGCCCCCGCCCGCCGCCACCGC
CTCCTCTCCGTCGACTACTATAACAAAACATGCCCTCACCTCGACCAGCTCGTCTCCTCAATCACTACCCAACAGTTCAAAGACGCACCAGTCTCAGCTCCAGCAACACTCCGCCTCTTC
TTCCATGATTGCTTTGTAGAA
GTAAGAAAATTCTAAAGCCCCATTTGGCCATTACCCTCAGCCACACCTACATTTTTACTACATGCATTGTGTAATCAATTTCAATTACCTGGATTTTGA
GAAAGCTCTTCAAAATGGCAGGGTTGTGATGGGTCGATTCTGATATCAACAAAGCCAGGCAGCAAAGTGGCGGCGGAAAAGGATGCAGTGGACAATAAAGGGCTGAGACCTGAGGCGTTT
GAAAGCATCAAGAAAGCAAAGGCGTTGGTTGAGAGCAAATGCCCTGGCGTTGTGTCTTGTGCTGACATCCTAGCAATCGCAGCCAGAGATTTTGTCCATTTG
GTGAGAGCCTTTGCCTTT
TCTCTTGATTCAATAAAATCTAGTCATTTTCTGCATATAAAACGGCACATTAAAAAAAGATTTAAGCAAAACATAAAGGATTGTGTTTGATAGTTAGTTCAATGATTTGATATTGAATGG
ACATTGTTACTATTCTGCTTAGATAATGTGAGGGATAGGCTAAATCAAAAGAAAAGAAAATACGTATAGATGCAGTATCAGTATCCTAGAAAATTTGCCACTGTCTCCATTATTTAATTA
GTAAGCTTGAGCAACACAAGAAGGAAAATGACAAGAAGAAGATGGTTCCGTTTATTATGGATCTGTAAAGAACACTTGGTCCACAGCATCGAAATGTAGATAAAAAAAAACTGTCTTTTC
AACTTCACCATTTTCCAGTTCAGTATGAAATCTAGTTCTGTAAAGTCAGATTCTGACACAATTCACAATCAGAAACACATCCTCATGTTCATGAAAAGCATACATTAAATGAGGACTTTA
TTGTTAAGTTGGTTATAAAATTATATTTACTAGAATACGAACACAATTGACTGCTGTCATGCAAATTGCAGCCAAGAAAACAATTCAAATCCAAATCGAAATTAAGCAAAAATTAAAGCA
GTAGATCAAAGTTCCATGTGCTTAAGNNNNNNNNNNNNNNNNNNNNNGTCTACAACTGGTTTACTACTAAGTTGTCCTTATCTAAACTCCACTATTTAATGTTATTTTCCTCTGTCCAAT
GATGCTTTAGTTAATAATCATCAATGTTTTTGGATTCTACATGGAAGAAAGGAAGAAATAATTGAAATATTCTACATGGAAGAAAGGAAGAAATAATCTCCCATGTCGTATAAGGATGAT
AAAAGTGATTTCCATCCCATCTTGGGCCAAAGCCCGTTAGGCTTCATTATGGATAAGCGGTTAGCCCAAAAGTGTTTGGACCTTTATAGGCCCATCATAAATTAAATTAGACATCAAATC
CAACTTCTGACCTATTTGATTTTTTTTTTCTTTGCATATTTAAACCTTTTGACTTTAAAATAATTAATACATATTTCATGTCGGTTAAGGTTTATTTTAGCTATGTAGATTATCAAGTTT
AAGAGTGTCTTATACAAGAGTTGAATTTTAAAAAGTATCAATCTTGCTTATGCTCTTATTGTCCTCTATGTTTATGAAGTTTGGAATTTTCGTCGGAAGTCTCTTCAATTCCTTAATAGA
CACTAAATTATTAAATTTAAACAGTTTAGAGTTGTAACAGACATACAGGATTCAATATCATATCTAATATACTAGTTAGTTAATTTGTGATTAGAGCATTATCAAACACGAAAGTTCCAA
AACAGACTTCCAAAGTTACTTTTAGATATAAAGTTAGAGTTTACGACTAAGATAAATTTAATTTTGTCAAATTTGAAAGCTGTGAATAAAAATACAAAAATCAAATGTTAAATTGATAAT
AAAAAGTATGTTTGAAAATAGTTTCTTCAAAAGTTAATAGTAATAACGATAATTTTAACCTTTCGTTTAAAGAAAAAACATATTGTCGTTAAGAAAAATAAATTCTGAAACGAGAAAATT
GCAGGCAGGAGGGCCGTATTACCCGGTGAAGAAGGGACGATGGGACGGGAAGATCTCCATGGCGTCCAGAATAGGTTCCAATCTACCACGAGCAAATTCCACCGTCGATCAACTTCTCAA
ACTCTTCAATTCCAAAGGTCTATCGGCCGATGATCTTGTCGTCCTCTCCGGTGCGCATACGATCGGATTTGCACACTGCGAGCACTTTACGAACCGTCTCTACGACTACAGAGGCACGAA
GCAACCTGATCCAGCGATCGACGGGAGACTGCTGAAGGAGCTGAAAATGTCGTGCCCCAGGTACGGGGGAAATACAGATATAGTGGCGCCATTCGATGTAACGACGCCGTTTGTGTTTGA
TCATGCGTACTACGGAAATTTGGAAGGGAAATTGGGATTGTTGGCTACGGATCAAGGTCTGGTTTCGGATGCGAGGATGAAGACGATGGTGCAGGGTTTGGCGAAGGATAAGCAGAAGTT
TTTTCAAGCTTTTGCGGCGGCGATGGACAAAATGGGATCGATTGGTGTGAAGAGAGGACGAAGACATGGAGAGCGAAGGACGGATTGTAGCATTCACCAGAGT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTGTCCCTTTTTCTCTTCTCTGTTTTCTCACTCTGCTTCTCATTTCCTACACACCATCAAAATGTGCCAATGCAAAACCACCACCACCTAAACAAGCCCCCGCCCGCCGCCACCGC
CTCCTCTCCGTCGACTACTATAACAAAACATGCCCTCACCTCGACCAGCTCGTCTCCTCAATCACTACCCAACAGTTCAAAGACGCACCAGTCTCAGCTCCAGCAACACTCCGCCTCTTC
TTCCATGATTGCTTTGTAGAA
GGTTGTGATGGGTCGATTCTGATATCAACAAAGCCAGGCAGCAAAGTGGCGGCGGAAAAGGATGCAGTGGACAATAAAGGGCTGAGACCTGAGGCGTTT
GAAAGCATCAAGAAAGCAAAGGCGTTGGTTGAGAGCAAATGCCCTGGCGTTGTGTCTTGTGCTGACATCCTAGCAATCGCAGCCAGAGATTTTGTCCATTTG
GCAGGAGGGCCGTATTAC
CCGGTGAAGAAGGGACGATGGGACGGGAAGATCTCCATGGCGTCCAGAATAGGTTCCAATCTACCACGAGCAAATTCCACCGTCGATCAACTTCTCAAACTCTTCAATTCCAAAGGTCTA
TCGGCCGATGATCTTGTCGTCCTCTCCGGTGCGCATACGATCGGATTTGCACACTGCGAGCACTTTACGAACCGTCTCTACGACTACAGAGGCACGAAGCAACCTGATCCAGCGATCGAC
GGGAGACTGCTGAAGGAGCTGAAAATGTCGTGCCCCAGGTACGGGGGAAATACAGATATAGTGGCGCCATTCGATGTAACGACGCCGTTTGTGTTTGATCATGCGTACTACGGAAATTTG
GAAGGGAAATTGGGATTGTTGGCTACGGATCAAGGTCTGGTTTCGGATGCGAGGATGAAGACGATGGTGCAGGGTTTGGCGAAGGATAAGCAGAAGTTTTTTCAAGCTTTTGCGGCGGCG
ATGGACAAAATGGGATCGATTGGTGTGAAGAGAGGACGAAGACATGGAGAGCGAAGGACGGATTGTAGCATTCACCAGAGT

Retrieve as FASTA