Entry information : CsaPrx73 (Cucsa.239780.1)
Entry ID 8847
Creation 2011-06-29 (Qiang Li)
Last sequence changes 2014-01-09 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2014-01-09 (Qiang Li)
Peroxidase information: CsaPrx73 (Cucsa.239780.1)
Name (synonym) CsaPrx73 (Cucsa.239780.1)
Class Class III peroxidase    [Orthogroup: Prx022]
Taxonomy Eukaryota Viridiplantae Streptophyta Cucurbitaceae Cucumis
Organism Cucumis sativus    [TaxId: 3659 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CsaPrx73
start..stop
S start..stop
PpePrx50 447 2e-158 46..384 6..341
PpePrx04 440 2e-155 51..384 3..346
MtPrx82 416 2e-145 1..384 6..383
VvPrx90 415 4e-145 9..384 12..369
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 669402..669689 288 N° 2 669110..669307 198 N° 3 668798..668963 166 N° 4 668198..668706 509
complement(join(668198..668706,668798..668963,669110..669307,669402..669689))


exon

Literature and cross-references CsaPrx73 (Cucsa.239780.1)
DNA ref. Phytozome 12:   scaffold02046 (669689..668198)
Protein sequence: CsaPrx73 (Cucsa.239780.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   386 (365)
PWM (Da):   %s   42968.37 (40669.1)  
PI (pH):   %s   6.13 (6.13) Peptide Signal:   %s   cut: 22 range:22-386
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MLNGWVVSVLFITLLVSLCNPRGVSDIKTLHFSETHTNTHTHTLFSFLSTLQYDFYRKSCPNAENIVRSSVANIYSHHQDISASLLRLFFHDCFIQGCDASILLDPITGDATYSTEKQAIPNLTLKGFHEIDQIKEELERVCPRVVSCADILSLATRDAVVLAGGPFYPVFTGRRDSTRAYFEEATADMPRPDDSINRTLYLFATRGLDERDMVSLLGAHNIGKIGCQFILNRLYNFSGTNLPDPSIDPEFLNHMRSKCQEKENNENNNGSQDQMSPASSPISKEASVEKLRRSTLDVSNFQELSSALSLEGGFDTHYYKSLLSGRGLLYADQQLMANEKTGRLVQGYASDDGSTFRRDFARAMVKLSVLDVLTGSQGQIRERCGY

Retrieve as FASTA  
Remarks Complete sequence from genomic. Incorrect prediction from phytozome (Bad prediction at both 3' end and 5' end).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTGAATGGTTGGGTTGTTTCAGTCCTCTTCATCACTCTCCTCGTTTCTCTCTGTAATCCAAGAGGCGTTTCCGACATTAAAACTCTTCATTTCTCTGAAACTCACACTAACACCCAC
ACCCACACCCTCTTCTCTTTCCTTTCAACTCTTCAGTACGATTTCTATCGAAAATCCTGCCCCAACGCCGAGAACATTGTAAGATCTTCCGTCGCTAACATTTACTCTCACCACCAAGAT
ATCTCCGCTTCTCTTCTTAGACTCTTCTTTCACGATTGCTTCATCCAG
GTATCCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCTCTTACA
TTTCCTTTTTTCCTTCAATTAGGGCTGCGATGCTTCCATCCTATTGGATCCCATTACCGGTGATGCAACCTATTCCACTGAGAAGCAGGCTATTCCCAATTTGACCTTAAAGGGTTTCCA
TGAGATTGATCAAATCAAGGAAGAGCTTGAAAGGGTTTGCCCACGTGTTGTTTCTTGTGCCGATATTCTTTCCCTTGCTACTAGAGATGCCGTCGTTCTG
GTAAAATACACATACCACTG
CATTTTTCTTTTTTTCTTTTTTTCATTTTCCCCATTTCTTGTAGTTCTTTCGAGCCTTTTTGATTGTGGGGTTTATTAGTTTAATGTGTTTCTCACATTCGACTAACTTAGTGATTCGGC
GCTTAGGCTGGTGGCCCCTTCTATCCAGTTTTCACGGGCAGACGAGACAGCACGAGGGCGTACTTTGAAGAAGCAACGGCGGACATGCCACGACCGGACGACAGCATCAATCGCACTCTT
TATCTATTTGCAACAAGAGGACTTGACGAAAGAGATATGGTCAGTCTTTTAG
GTATGTCAAAATAAAACTAGCTCTTCCTTCAAACTCATTCTCCTCACAAATCACAATTAGTTTCAGTC
ATTACCTTTTTTGGCTTTTCAAGGAGCGCATAACATTGGGAAGATTGGGTGTCAGTTCATTCTGAATCGTCTTTATAACTTTTCTGGAACCAACCTACCAGATCCATCAATTGACCCTGA
GTTCCTAAACCACATGAGATCCAAGTGCCAAGAGAAGGAGAACAATGAAAACAACAATGGCAGTCAAGATCAAATGTCTCCAGCATCATCCCCAATTTCAAAGGAGGCATCAGTAGAGAA
GCTGAGAAGGTCTACATTGGACGTGTCAAACTTTCAAGAACTGTCATCTGCATTGTCGTTGGAGGGAGGTTTCGACACTCATTACTACAAGAGCTTGTTGAGTGGGAGAGGATTGTTGTA
TGCTGATCAGCAACTAATGGCAAACGAGAAAACTGGGAGACTGGTACAGGGTTATGCTTCTGATGATGGCTCTACCTTTCGCAGGGACTTTGCAAGGGCTATGGTCAAGCTATCGGTTCT
TGATGTTCTGACTGGTTCTCAAGGTCAAATCCGTGAGAGATGCGGGTACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTGAATGGTTGGGTTGTTTCAGTCCTCTTCATCACTCTCCTCGTTTCTCTCTGTAATCCAAGAGGCGTTTCCGACATTAAAACTCTTCATTTCTCTGAAACTCACACTAACACCCAC
ACCCACACCCTCTTCTCTTTCCTTTCAACTCTTCAGTACGATTTCTATCGAAAATCCTGCCCCAACGCCGAGAACATTGTAAGATCTTCCGTCGCTAACATTTACTCTCACCACCAAGAT
ATCTCCGCTTCTCTTCTTAGACTCTTCTTTCACGATTGCTTCATCCAG
GGCTGCGATGCTTCCATCCTATTGGATCCCATTACCGGTGATGCAACCTATTCCACTGAGAAGCAGGCTATT
CCCAATTTGACCTTAAAGGGTTTCCATGAGATTGATCAAATCAAGGAAGAGCTTGAAAGGGTTTGCCCACGTGTTGTTTCTTGTGCCGATATTCTTTCCCTTGCTACTAGAGATGCCGTC
GTTCTG
GCTGGTGGCCCCTTCTATCCAGTTTTCACGGGCAGACGAGACAGCACGAGGGCGTACTTTGAAGAAGCAACGGCGGACATGCCACGACCGGACGACAGCATCAATCGCACTCTT
TATCTATTTGCAACAAGAGGACTTGACGAAAGAGATATGGTCAGTCTTTTAG
GAGCGCATAACATTGGGAAGATTGGGTGTCAGTTCATTCTGAATCGTCTTTATAACTTTTCTGGAACC
AACCTACCAGATCCATCAATTGACCCTGAGTTCCTAAACCACATGAGATCCAAGTGCCAAGAGAAGGAGAACAATGAAAACAACAATGGCAGTCAAGATCAAATGTCTCCAGCATCATCC
CCAATTTCAAAGGAGGCATCAGTAGAGAAGCTGAGAAGGTCTACATTGGACGTGTCAAACTTTCAAGAACTGTCATCTGCATTGTCGTTGGAGGGAGGTTTCGACACTCATTACTACAAG
AGCTTGTTGAGTGGGAGAGGATTGTTGTATGCTGATCAGCAACTAATGGCAAACGAGAAAACTGGGAGACTGGTACAGGGTTATGCTTCTGATGATGGCTCTACCTTTCGCAGGGACTTT
GCAAGGGCTATGGTCAAGCTATCGGTTCTTGATGTTCTGACTGGTTCTCAAGGTCAAATCCGTGAGAGATGCGGGTACTAA

Retrieve as FASTA