Entry information : CsaPrx75 (Cucsa.251120.1)
Entry ID 8848
Creation 2011-06-29 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: CsaPrx75 (Cucsa.251120.1)
Name (synonym) CsaPrx75 (Cucsa.251120.1)
Class Class III peroxidase    [Orthogroup: Prx036]
Taxonomy Eukaryota Viridiplantae Streptophyta Cucurbitaceae Cucumis
Organism Cucumis sativus    [TaxId: 3659 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CsaPrx75
start..stop
S start..stop
EgrPrx56 508 0 9..316 16..323
EgrPrx102 504 0 7..316 14..323
EcamPrx56 502 0 9..313 16..320
EglPrx56 502 0 9..316 16..323
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 233886..234083 198 N° 2 234218..234406 189 N° 3 235575..236138 564  
join(233886..234083,234218..234406,235575..236138)


exon

Literature and cross-references CsaPrx75 (Cucsa.251120.1)
DNA ref. Phytozome 12:   scaffold02229 (233886..236138)
Protein sequence: CsaPrx75 (Cucsa.251120.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   317 (297)
PWM (Da):   %s   34543.5 (32390.4)  
PI (pH):   %s   7.71 (7.75) Peptide Signal:   %s   cut: 20 range:20-316
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAKSASLLFLIMMVCLSEAVLDSHYYSKTCPNAENIILQTVYNASIHDPKVPARLLRLFFHDCFIRGCDGSVLIDSTPENQAEKDAPPNISLRSFYVIDEAKAKLESACPHTVSCADIVAIAARDVVTLSGGPYWSVLKGRKDGKISKASETINLPAPTFNVSQLIQSFANRGLDVKDMVALSGAHTLGFSHCSSFQSRLRNFSATHEIDPTLESGFAQILRNKCPKPNVDKNAGQFLDPTSSTFDNVYYKRLLEGKGVFGSDQALFVDSRTRGLVGLFAQDQNLFFKEFAASMVSLGNVGVIQNGNVRIDCRVPN*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAAAAAGTGCATCACTTTTGTTCCTAATTATGATGGTTTGTCTGTCGGAAGCAGTTCTTGATAGCCATTATTACTCAAAAACATGTCCCAATGCAGAAAATATCATTCTTCAAACC
GTCTACAATGCTTCCATTCATGACCCCAAAGTCCCTGCTCGTCTTCTTAGACTCTTCTTTCATGACTGTTTCATAAGG
GTATTATAAACTCGGACTCCATCTGTTAGAATTTTTTGTCAT
TTGTAAATGTGGTAGACATGAATTGAAATAAGTGAGAGTAATGTGAAGAATTGTTTTATATTGAAGTGTAAGACTGTTGTTTTCTTTTCTAGGGATGTGATGGTTCGGTGTTGATAGACT
CGACACCAGAGAACCAGGCGGAGAAAGATGCACCTCCAAACATCTCGCTAAGGTCATTCTATGTGATAGATGAGGCCAAAGCCAAGCTTGAAAGTGCATGCCCACATACTGTTTCTTGTG
CTGATATTGTTGCTATTGCTGCTAGAGATGTAGTAACTTTG
GTATGAAACTTGATTCTCCCTAGAATTTTAAGATTGTCTCTTTCCACACTAAATAAAAAGGTTTCTAATCGATGTATGA
ACCTTTGAAGTTGTTCCAGAAGGTTTTGATAACACTCTTAACTTTCATTTAGTGTCTAATAGATAATTATAGAAGGTAATTATATAATAAACCATNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNTGATGTAGTTCATTTTATTAGTTTAACGATCAAGTAACATAGTAAACATATTACTTGAAAGAATGAGCCAGTACGGTAGTAAGTTGATTTAGGTAGGTTTAGATA
TTTGATTTTAAAGTGTCACAGAAACTGAACTAATGGTAGGGAAGGGAACTGTTAGAAATAAACTTGAAAGTTTGGAGTCTTTGGACCGTTATAAAGCATGCACAAGTTCGAAAATTCAAT
AGACATGGCTTTACAAGTTAAGGAGTAAAATAATATCTTAAGCTAAATGTGGAATTCATCCTAAGATTTATCATTTAAGATTAGTAATATTTACTTTCATTTCCTCTTTGTTGGAAAAAA
AAAATGCAGTCTGGAGGCCCATATTGGAGTGTACTCAAAGGAAGGAAAGATGGGAAGATTTCAAAGGCTTCTGAGACCATCAACTTGCCAGCTCCAACTTTCAATGTCTCCCAACTCATT
CAGAGCTTTGCAAACAGAGGATTAGATGTTAAGGACATGGTTGCTCTATCTGGGGCTCACACACTTGGATTCTCACACTGTTCTTCCTTTCAATCTCGACTTCGAAACTTCAGCGCGACT
CATGAAATTGATCCTACTTTGGAATCTGGGTTTGCTCAAATTCTAAGAAACAAATGTCCAAAACCAAACGTGGACAAAAATGCTGGACAGTTCTTGGACCCAACTTCCTCAACTTTTGAC
AATGTGTATTACAAGAGACTGTTGGAAGGAAAGGGTGTGTTTGGTTCTGATCAAGCTCTGTTTGTTGATTCTAGAACTAGAGGGCTTGTTGGGTTGTTTGCTCAAGATCAGAACTTGTTC
TTTAAGGAGTTTGCAGCTTCAATGGTGAGTTTGGGTAATGTTGGGGTAATTCAGAATGGAAATGTCAGAATCGATTGCCGGGTGCCAAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAAAAAGTGCATCACTTTTGTTCCTAATTATGATGGTTTGTCTGTCGGAAGCAGTTCTTGATAGCCATTATTACTCAAAAACATGTCCCAATGCAGAAAATATCATTCTTCAAACC
GTCTACAATGCTTCCATTCATGACCCCAAAGTCCCTGCTCGTCTTCTTAGACTCTTCTTTCATGACTGTTTCATAAGG
GGATGTGATGGTTCGGTGTTGATAGACTCGACACCAGAGAAC
CAGGCGGAGAAAGATGCACCTCCAAACATCTCGCTAAGGTCATTCTATGTGATAGATGAGGCCAAAGCCAAGCTTGAAAGTGCATGCCCACATACTGTTTCTTGTGCTGATATTGTTGCT
ATTGCTGCTAGAGATGTAGTAACTTTG
TCTGGAGGCCCATATTGGAGTGTACTCAAAGGAAGGAAAGATGGGAAGATTTCAAAGGCTTCTGAGACCATCAACTTGCCAGCTCCAACTTTC
AATGTCTCCCAACTCATTCAGAGCTTTGCAAACAGAGGATTAGATGTTAAGGACATGGTTGCTCTATCTGGGGCTCACACACTTGGATTCTCACACTGTTCTTCCTTTCAATCTCGACTT
CGAAACTTCAGCGCGACTCATGAAATTGATCCTACTTTGGAATCTGGGTTTGCTCAAATTCTAAGAAACAAATGTCCAAAACCAAACGTGGACAAAAATGCTGGACAGTTCTTGGACCCA
ACTTCCTCAACTTTTGACAATGTGTATTACAAGAGACTGTTGGAAGGAAAGGGTGTGTTTGGTTCTGATCAAGCTCTGTTTGTTGATTCTAGAACTAGAGGGCTTGTTGGGTTGTTTGCT
CAAGATCAGAACTTGTTCTTTAAGGAGTTTGCAGCTTCAATGGTGAGTTTGGGTAATGTTGGGGTAATTCAGAATGGAAATGTCAGAATCGATTGCCGGGTGCCAAACTAA

Retrieve as FASTA