Entry information : CsaPrx76 (Cucsa.271330.1)
Entry ID 8849
Creation 2011-06-29 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: CsaPrx76 (Cucsa.271330.1)
Name (synonym) CsaPrx76 (Cucsa.271330.1)
Class Class III peroxidase    [Orthogroup: Prx030]
Taxonomy Eukaryota Viridiplantae Streptophyta Cucurbitaceae Cucumis
Organism Cucumis sativus    [TaxId: 3659 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CsaPrx76
start..stop
S start..stop
PpePrx76 487 4e-175 6..326 7..327
EgrPrx73 485 1e-174 14..326 13..325
EcamPrx73 483 7e-174 14..326 13..325
EglPrx73 481 7e-173 14..326 13..325
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 250307..250528 222 N° 2 249210..249389 180 N° 3 247800..248381 582  
complement(join(247800..248381,249210..249389,250307..250528))


exon

Literature and cross-references CsaPrx76 (Cucsa.271330.1)
DNA ref. Phytozome 12:   scaffold02500 (250528..247800)
Protein sequence: CsaPrx76 (Cucsa.271330.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   328
PWM (Da):   %s   34851.24 Transmb domain:   %s   i13-35o
PI (pH):   %s   4.89
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAETASYINTCKSFLVFLALSFPATTLALSFGFYAATCPAAELMVRNTVRSASSVDPTVPGKLLRLLFHDCFVEGCDASVLVEGNGTERSDPANKSLGGFEVIDSAKRTLEIFCPGTVSCADIVVLAARDAVEFTGGPSVQVPTGRRDGKISAASNVRPNIADTSFSVNQMMNLFSSKGLSVDDLVILSGAHTIGTSHCSAFSDRFRRNPNGQLTLIDASLDGAYADELMRRCPAGASTAATVENDPATSSVFDNQYYRNILSHRGLLQSDSVLISDGRTRARVESFANDEIGFFENWAQSFLKLSSVGVKSGDEGEIRLSCSTPNV*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGAAACGGCGTCGTATATCAACACATGCAAGTCGTTTTTAGTTTTTCTGGCTTTGTCTTTTCCGGCGACAACGCTGGCATTGTCCTTCGGATTTTACGCCGCCACGTGTCCCGCC
GCCGAGTTAATGGTTAGGAACACCGTCAGATCGGCTTCCTCCGTTGACCCCACCGTCCCCGGCAAGCTCCTCCGGTTGCTATTCCATGACTGTTTTGTTGAG
GTTAGTTAACTTCAAACC
GATCTGCTTTTCTTTTGGTAAAACGACGACGCATTTCCTCCCCACCGTTGAAGCCCTTATTTTTCTTTTCTACTCTGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNCCACAAACTAAATTAATACACATCTGAAAAAATATTTGGATTTTTTTAGACATGGTTCATATTTCCTAAAAATCTGGTTTTAAAATTTTATTTTA
GTAGTTGAATCTTTTTTGTTTGATTTATTGGAAATAAAAAAAAGATATACGTAGAAAACGATAAATAAAAATAGTATTTATAGGTTTAATTTTAAAAAGAAAGCAAGGTGACAGTAAAAT
TTCAACCTTTTTCTACTAATTGTTTGTTGAACCACATTAGTACCTTTATGAGTACTAATTTTTTGGCCGTGCATGTCCATACTTTTAAGCATTATTAAGTTTACGGNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTTTTAGACTTCAAGTTTCAAGTTTCAAGTTTTTAGGTAGAACTCATCCAAGGTCTATTAGTTAATTAAAGCATCATTATAACAGTTTTGC
ATATAAGTAAAACTACTTTTATCTTTATAACTTTAATTTGTTCGGATTTAATTTTTAATCGATCTTCAGAGTTATCTTTATAACTTTAATTTGTTCGGTTTTAATTTTTAATCGAGCTTA
AGAGTTCTTAAAATTGAACTTTAATCCAAATTGATTAAGTAATAATTATTATTTACATGCAATTAATTACAATATAATGATATAAAAAAGTTAAGAATTATTAAAAGTGTAGAGATTAAA
ATAATGTTAGTAGTATATTATTTTATCAACTGAGTGTTTCAAAATTTCAAAACATACAGGGATGTGATGCTTCTGTATTGGTGGAAGGAAATGGAACGGAACGAAGCGATCCGGCAAACA
AGTCACTTGGAGGATTCGAAGTAATCGATTCAGCTAAGAGAACTTTAGAAATTTTTTGTCCCGGAACTGTTTCATGTGCCGATATTGTCGTTTTAGCCGCCAGAGATGCAGTTGAATTC
G
TGAGTTTAATTTTCATCCTTTACATTTCCAAAGTCATTTTTAAAACAACTGATAGTTATCCATAATTTTTCTTTCCTTTTATCAACATATTTACTATTTGAATCACATATCTCTAAATAG
TAAAAATATATATATATATACATTGGTTAATTGAATTATGACCATCTTACCAAATTTATTTTAAAAGATAGATTTTTAAAAAATGAATATACCATAAGAAAGAGCGTACTTATAATTAAT
CAACTTGTTATTTGAATAACACAATTGCGAAAATGTAAAACAAAATAATAAAAGCAATTCCTTTTGGCCAAAATAGGCAATCAATCAAAAAAGAAAAAAATATATCAATTATAGCCTAAT
AAAAATTAGGTCACACTCAAAATTATATATTTAGGTTTGAGAATTTTTAGTTTATAGTATAAATAGAGCATGAAAGAAATAGATTTGTGTGTTGTAAAATGACTGCTTTAGTAATATATA
GTATTACTTTTGTTTCTAAATTATTTATTGTTGATGGCTCCTAGTGGTTAACGCAATTCATTTCTAAATATGAAAAAGAAGGTTGTTAGTATTGGAAAAGTCTAAATTGGCAAATCTAAA
ACTTAAAAGAGTTGAAGCGACCAATTTTTACTTTTGACGATCGAATTCTACTAAATTTGATATATCCAAAATTAACATTGTTCTTGTAAACGGGTCTAACCNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNGGGACAAACTTGTAATTTAAGTTACAAGTACAATGATTGAAATAAACTAAACAATACTCCAAATTCTCTTCATCCTTAGCACAGACCGGTGGGCCCT
CCGTTCAAGTCCCGACCGGCCGAAGAGACGGAAAGATATCAGCGGCGTCAAACGTCCGGCCAAACATCGCCGACACAAGCTTTTCAGTCAACCAGATGATGAATCTCTTCTCATCAAAAG
GACTGTCGGTGGACGATCTCGTCATCCTCTCCGGTGCCCACACCATCGGAACCTCCCACTGCAGCGCCTTCAGCGACCGCTTCCGACGAAACCCAAACGGCCAACTGACCCTCATCGACG
CCTCTCTAGACGGGGCCTACGCCGACGAGCTCATGCGGCGGTGCCCTGCAGGCGCCTCCACTGCCGCCACCGTCGAAAACGATCCGGCTACGTCGTCTGTCTTCGACAATCAGTATTACA
GAAACATTTTGTCACATAGAGGGCTGTTGCAGTCGGATTCCGTTCTGATCAGCGACGGCCGGACTAGAGCTCGGGTGGAGAGCTTCGCGAATGATGAGATTGGGTTCTTTGAGAACTGGG
CCCAGTCGTTCTTGAAACTTAGTAGCGTTGGAGTTAAGAGTGGGGATGAAGGGGAAATTAGGTTGTCTTGTTCTACTCCTAATGTTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGAAACGGCGTCGTATATCAACACATGCAAGTCGTTTTTAGTTTTTCTGGCTTTGTCTTTTCCGGCGACAACGCTGGCATTGTCCTTCGGATTTTACGCCGCCACGTGTCCCGCC
GCCGAGTTAATGGTTAGGAACACCGTCAGATCGGCTTCCTCCGTTGACCCCACCGTCCCCGGCAAGCTCCTCCGGTTGCTATTCCATGACTGTTTTGTTGAG
GGATGTGATGCTTCTGTA
TTGGTGGAAGGAAATGGAACGGAACGAAGCGATCCGGCAAACAAGTCACTTGGAGGATTCGAAGTAATCGATTCAGCTAAGAGAACTTTAGAAATTTTTTGTCCCGGAACTGTTTCATGT
GCCGATATTGTCGTTTTAGCCGCCAGAGATGCAGTTGAATTC
ACCGGTGGGCCCTCCGTTCAAGTCCCGACCGGCCGAAGAGACGGAAAGATATCAGCGGCGTCAAACGTCCGGCCAAAC
ATCGCCGACACAAGCTTTTCAGTCAACCAGATGATGAATCTCTTCTCATCAAAAGGACTGTCGGTGGACGATCTCGTCATCCTCTCCGGTGCCCACACCATCGGAACCTCCCACTGCAGC
GCCTTCAGCGACCGCTTCCGACGAAACCCAAACGGCCAACTGACCCTCATCGACGCCTCTCTAGACGGGGCCTACGCCGACGAGCTCATGCGGCGGTGCCCTGCAGGCGCCTCCACTGCC
GCCACCGTCGAAAACGATCCGGCTACGTCGTCTGTCTTCGACAATCAGTATTACAGAAACATTTTGTCACATAGAGGGCTGTTGCAGTCGGATTCCGTTCTGATCAGCGACGGCCGGACT
AGAGCTCGGGTGGAGAGCTTCGCGAATGATGAGATTGGGTTCTTTGAGAACTGGGCCCAGTCGTTCTTGAAACTTAGTAGCGTTGGAGTTAAGAGTGGGGATGAAGGGGAAATTAGGTTG
TCTTGTTCTACTCCTAATGTTTGA

Retrieve as FASTA