Entry information : SbPrx100 (Sobic.006G277700.1 [2.1] / SB06G033860 [1.4])
Entry ID 885
Creation 2006-01-06 (Christophe Dunand)
Last sequence changes 2011-01-18 (Toky Ramarohetra (Scipio))
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-08-04 (Messaoudi)
Peroxidase information: SbPrx100 (Sobic.006G277700.1 [2.1] / SB06G033860 [1.4])
Name (synonym) SbPrx100 (Sobic.006G277700.1 [2.1] / SB06G033860 [1.4])
Class Class III peroxidase    [Orthogroup: Prx211]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation N/D
Tissue types Pollens
Roots
Seedlings
Inducers Acid treatment
Alkaline treatment
Nitrogen starvation
Salt stress
Repressor N/D
Best BLASTp hits
Perox score E-value SbPrx100
start..stop
S start..stop
ZmPrx59 322 5e-109 49..363 58..377
SbPrx101 305 2e-102 13..362 5..338
ZmPrx[P]47 294 1e-98 35..362 26..337
OsPrx62 288 4e-96 1..363 4..350
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 61792411..61792890 480 N° 2 61791668..61792279 612  
complement(join(61791668..61792279,61792411..61792890))


exon

Literature and cross-references SbPrx100 (Sobic.006G277700.1 [2.1] / SB06G033860 [1.4])
Literature Cordonnier-Pratt,M.-M. et al., unpublished
DNA ref. Phytozome 12:   chromosome_6 (61792890..61791668)
Cluster/Prediction ref. PlantGDB:   SbGSStuc11-12-04.51397.1
Protein sequence: SbPrx100 (Sobic.006G277700.1 [2.1] / SB06G033860 [1.4])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   363 (338)
PWM (Da):   %s   38709.07 (36148.7) Transmb domain:   %s   i7-29o
PI (pH):   %s   6.38 (6.31) Peptide Signal:   %s   cut: 26 range:26-363
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MARSGNNVVVHVLVAMVVLWDGAAAGAAALPLPDLETTTTMNDTVTGSLSADFHLESCPDLHSMVRSAVQAARNQDVQITAGLLRIFFHDCFPQGCDASLLLDKTHPGSEQHVHPQNAGLNHKALQLIESIRDMVHRRCGERSVSCADILAVATSHAVNLAGGPFINMQLGHRDSVDPAQPWQVQTLPAPTADVTTLFNSFAGKGFVNAIDVVALSGAHTVGKARCSSFSDRTNNPNDDGFARELAAFCAGDGNRQHNLDVITPDSFDNRYFADLINRKGVLTSDQALTNDGRTAWIVNVFAHDQANFFQKFAQAMEKMSRLTSPGGVKARRNCFKRDAGVNIQTTVAAAGSGDDESQLAASA*

Retrieve as FASTA  
Remarks Complete sequence from 5 ESTs + 7 ESTs and genomic (chromo 6, intron 2).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAAGATCAGGCAACAACGTCGTCGTCCATGTCCTGGTGGCCATGGTCGTCCTGTGGGACGGAGCCGCAGCAGGGGCGGCGGCGTTGCCTCTGCCTGATTTGGAGACGACGACGACG
ATGAACGACACGGTCACGGGGAGCTTGTCGGCGGACTTCCATTTGGAGTCGTGCCCGGACCTGCATAGCATGGTGCGGTCCGCCGTGCAGGCCGCGCGGAACCAGGACGTGCAGATCACC
GCGGGCCTCCTGCGCATCTTCTTCCACGACTGCTTCCCGCAGGGGTGCGACGCGTCGCTGCTGCTGGACAAGACCCACCCCGGCAGCGAGCAGCACGTCCACCCGCAGAACGCGGGCCTG
AACCACAAGGCGCTGCAGCTCATCGAGAGCATCCGAGACATGGTGCACAGGAGGTGTGGAGAAAGAAGCGTCTCGTGCGCCGACATCCTCGCCGTCGCAACCAGCCACGCCGTCAACCTG
GTACGTATGTGTATTGTTGCACGTACGTGGACGACGTAGATATATATATATATATATATATATATATATATATATATATATATATATATATATGCCTGTCAAATCATATCATATCTCATG
CATGCGCACAGGCCGGTGGCCCTTTCATCAACATGCAACTCGGCCACCGTGATAGCGTGGACCCTGCACAACCATGGCAAGTGCAGACCTTGCCGGCCCCCACCGCCGACGTCACCACGC
TCTTCAACAGCTTCGCCGGCAAGGGCTTCGTCAACGCCATCGACGTAGTGGCGCTCTCCGGCGCCCACACCGTCGGCAAGGCGCGCTGCAGCTCCTTCAGCGACCGCACCAACAACCCCA
ACGACGACGGCTTCGCCAGGGAGCTCGCCGCCTTCTGCGCCGGCGACGGCAACCGCCAGCACAACCTGGACGTGATCACGCCGGACTCGTTCGACAACAGGTACTTTGCTGACCTCATCA
ACAGGAAGGGAGTGCTCACCTCCGACCAGGCGCTCACCAACGACGGCCGCACCGCCTGGATCGTCAACGTCTTCGCCCACGACCAGGCCAACTTCTTCCAAAAGTTTGCGCAGGCCATGG
AGAAGATGAGCAGGCTGACGAGCCCCGGAGGCGTCAAAGCCCGCCGCAACTGCTTCAAGCGCGACGCCGGCGTCAACATCCAGACCACCGTTGCAGCTGCTGGCTCAGGCGACGACGAGA
GCCAGCTTGCGGCCTCTGCTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAAGATCAGGCAACAACGTCGTCGTCCATGTCCTGGTGGCCATGGTCGTCCTGTGGGACGGAGCCGCAGCAGGGGCGGCGGCGTTGCCTCTGCCTGATTTGGAGACGACGACGACG
ATGAACGACACGGTCACGGGGAGCTTGTCGGCGGACTTCCATTTGGAGTCGTGCCCGGACCTGCATAGCATGGTGCGGTCCGCCGTGCAGGCCGCGCGGAACCAGGACGTGCAGATCACC
GCGGGCCTCCTGCGCATCTTCTTCCACGACTGCTTCCCGCAGGGGTGCGACGCGTCGCTGCTGCTGGACAAGACCCACCCCGGCAGCGAGCAGCACGTCCACCCGCAGAACGCGGGCCTG
AACCACAAGGCGCTGCAGCTCATCGAGAGCATCCGAGACATGGTGCACAGGAGGTGTGGAGAAAGAAGCGTCTCGTGCGCCGACATCCTCGCCGTCGCAACCAGCCACGCCGTCAACCTG
GCCGGTGGCCCTTTCATCAACATGCAACTCGGCCACCGTGATAGCGTGGACCCTGCACAACCATGGCAAGTGCAGACCTTGCCGGCCCCCACCGCCGACGTCACCACGCTCTTCAACAGC
TTCGCCGGCAAGGGCTTCGTCAACGCCATCGACGTAGTGGCGCTCTCCGGCGCCCACACCGTCGGCAAGGCGCGCTGCAGCTCCTTCAGCGACCGCACCAACAACCCCAACGACGACGGC
TTCGCCAGGGAGCTCGCCGCCTTCTGCGCCGGCGACGGCAACCGCCAGCACAACCTGGACGTGATCACGCCGGACTCGTTCGACAACAGGTACTTTGCTGACCTCATCAACAGGAAGGGA
GTGCTCACCTCCGACCAGGCGCTCACCAACGACGGCCGCACCGCCTGGATCGTCAACGTCTTCGCCCACGACCAGGCCAACTTCTTCCAAAAGTTTGCGCAGGCCATGGAGAAGATGAGC
AGGCTGACGAGCCCCGGAGGCGTCAAAGCCCGCCGCAACTGCTTCAAGCGCGACGCCGGCGTCAACATCCAGACCACCGTTGCAGCTGCTGGCTCAGGCGACGACGAGAGCCAGCTTGCG
GCCTCTGCTTGA

Retrieve as FASTA