Entry information : CsPrx60 (orange1.1g035963m/orange1.1t03236)
Entry ID 8863
Creation 2011-07-01 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2017-12-14 (Qiang Li)
Peroxidase information: CsPrx60 (orange1.1g035963m/orange1.1t03236)
Name (synonym) CsPrx60 (orange1.1g035963m/orange1.1t03236)
Class Class III peroxidase    [Orthogroup: Prx084]
Taxonomy Eukaryota Viridiplantae Streptophyta Rutaceae Citrus
Organism Citrus sinensis    [TaxId: 2711 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CsPrx60
start..stop
S start..stop
CclPrx100 624 0 62..360 1..299
MtPrx18 431 2e-152 64..359 42..335
PpePrx49 430 5e-152 50..357 29..335
GmPrx167 424 1e-149 64..357 47..338
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 143300..143623 324 N° 2 144134..144892 759  
join(143300..143623,144134..144892)


exon

Literature and cross-references CsPrx60 (orange1.1g035963m/orange1.1t03236)
DNA ref. Citrus sinensis Annotation Project:   chrUn (49914368..49915960) Phytozome 12:   scaffold00052 (143300..144892)
Protein sequence: CsPrx60 (orange1.1g035963m/orange1.1t03236)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   361 (334)
PWM (Da):   %s   39826.73 (36644.0)  
PI (pH):   %s   9.42 (9.26) Peptide Signal:   %s   cut: 27 range:27-360
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKSKQFTLFALILVQILEQFMINVLAININNNNNILPLEHVTTTSLLTNNEASKLLLSPESYLSLSHYHSTCPDLEGIIHRQVQAWIRKDYTFAASLIRLHFHDCVVRGCDASIMLSHKGSERRAKVSKTLRGFRIIDEIKAEVEKKCPKTVSCADILTAAARDATVVAGGPFWEVPFGRKDGKISSAREANRLVPQGHENVTTLIQIFRDHGLNILDLVVLSGAHTIGRSSCDAINHRLHNFNGTRKADPSLDTKYLNSLKKKCAASSHVYVDLDATTPRIFDTAYYTNLGRNMGLLSTDQLLNSDARTGPFVSVLASQPLVFSSQFAASMVKLGNIGVLARPNEGEIRFKCSSVNRAY*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGTCGAAACAATTCACTCTGTTCGCGCTCATCCTGGTCCAAATATTGGAGCAGTTTATGATTAATGTGTTGGCTATCAATATTAACAACAACAATAATATTTTACCTTTGGAACAT
GTCACTACCACTTCACTTTTAACAAATAATGAGGCGTCCAAGCTCTTATTATCTCCGGAAAGTTACTTGTCTTTGAGTCACTATCATTCAACATGTCCAGATCTTGAAGGCATCATCCAC
CGCCAAGTGCAAGCCTGGATTAGGAAGGACTACACATTCGCTGCCAGCCTCATCCGCCTCCACTTCCATGACTGTGTTGTTAGG
GTAAGCTAATTTCATTTACATATTACTCTAAATTAC
TCTTACTCTTACTCACCCAATTGATACATAATTAATTGTTTCAAGTTTCAATTGTATTAATATTATTATTATCATTTTATTTATTACACAAGCAGCACAATCCAAGATCTATTTATACGT
AGTAATGATTCAGTGGATATATGAAATAATTACCTACAGCTGGTTAATTTACATACTACATACTTATTATTTTAACCTATATATACAGTTAATTTTTACCTTCAAGTTTAACAGTTTTTC
ATTCAATTCTGACTCCATCCTTGATTTTTCTCGTGCAACTAGTAAACCATAGGCTAAAATAAATAATTAAATGAATAAATTTATCATACCGTTCTCTCCTTCTTAGTTAATTATGTCATT
ACTGTTCTTTATGTTATGCTGTCTCCGTTAATTATCTATGACCCCCATCGAACCAAAATGACTAGTAATATGTGTGTGTCTGTGTGTGTATATAAAATATGTTTGATGCTGCAGGGTTGT
GATGCTTCAATAATGCTGAGCCATAAAGGCAGCGAAAGGAGAGCCAAGGTGAGCAAGACACTGAGAGGCTTCAGAATCATCGATGAGATCAAGGCTGAGGTTGAGAAGAAATGCCCTAAA
ACTGTATCATGTGCTGACATTCTGACAGCAGCAGCTAGAGATGCAACAGTAGTAGCCGGAGGCCCATTCTGGGAAGTCCCGTTTGGCCGAAAAGACGGAAAGATTTCCAGTGCAAGAGAA
GCAAATCGCCTTGTTCCTCAGGGACACGAAAATGTCACAACTTTGATCCAAATTTTCCGAGATCATGGCTTGAACATTCTTGACCTGGTCGTCCTCTCAGGGGCACATACTATTGGCAGA
AGCTCTTGCGACGCCATAAATCATAGGCTCCATAACTTCAATGGTACGCGAAAAGCTGATCCTTCACTTGATACAAAGTATTTGAACTCGTTGAAGAAAAAATGTGCTGCTAGCAGTCAT
GTCTATGTTGATCTTGATGCAACAACGCCTAGGATTTTCGACACAGCTTATTACACCAATCTTGGGAGGAATATGGGATTGTTATCGACCGATCAACTGTTGAATTCTGATGCAAGAACT
GGACCATTTGTTTCAGTACTGGCCTCTCAGCCATTAGTTTTCTCCTCCCAATTTGCGGCGTCAATGGTCAAACTTGGTAACATTGGAGTGCTCGCTCGCCCCAACGAAGGTGAAATCAGA
TTCAAGTGCAGTTCTGTCAATCGAGCTTATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGTCGAAACAATTCACTCTGTTCGCGCTCATCCTGGTCCAAATATTGGAGCAGTTTATGATTAATGTGTTGGCTATCAATATTAACAACAACAATAATATTTTACCTTTGGAACAT
GTCACTACCACTTCACTTTTAACAAATAATGAGGCGTCCAAGCTCTTATTATCTCCGGAAAGTTACTTGTCTTTGAGTCACTATCATTCAACATGTCCAGATCTTGAAGGCATCATCCAC
CGCCAAGTGCAAGCCTGGATTAGGAAGGACTACACATTCGCTGCCAGCCTCATCCGCCTCCACTTCCATGACTGTGTTGTTAGG
GGTTGTGATGCTTCAATAATGCTGAGCCATAAAGGC
AGCGAAAGGAGAGCCAAGGTGAGCAAGACACTGAGAGGCTTCAGAATCATCGATGAGATCAAGGCTGAGGTTGAGAAGAAATGCCCTAAAACTGTATCATGTGCTGACATTCTGACAGCA
GCAGCTAGAGATGCAACAGTAGTAGCCGGAGGCCCATTCTGGGAAGTCCCGTTTGGCCGAAAAGACGGAAAGATTTCCAGTGCAAGAGAAGCAAATCGCCTTGTTCCTCAGGGACACGAA
AATGTCACAACTTTGATCCAAATTTTCCGAGATCATGGCTTGAACATTCTTGACCTGGTCGTCCTCTCAGGGGCACATACTATTGGCAGAAGCTCTTGCGACGCCATAAATCATAGGCTC
CATAACTTCAATGGTACGCGAAAAGCTGATCCTTCACTTGATACAAAGTATTTGAACTCGTTGAAGAAAAAATGTGCTGCTAGCAGTCATGTCTATGTTGATCTTGATGCAACAACGCCT
AGGATTTTCGACACAGCTTATTACACCAATCTTGGGAGGAATATGGGATTGTTATCGACCGATCAACTGTTGAATTCTGATGCAAGAACTGGACCATTTGTTTCAGTACTGGCCTCTCAG
CCATTAGTTTTCTCCTCCCAATTTGCGGCGTCAATGGTCAAACTTGGTAACATTGGAGTGCTCGCTCGCCCCAACGAAGGTGAAATCAGATTCAAGTGCAGTTCTGTCAATCGAGCTTAT
TAA

Retrieve as FASTA