Entry information : SbRboh (Sobic.001G303600.1[2.1] / Sb01g029540[1.4])
Entry ID 887
Creation 2008-10-24 (Christophe Dunand)
Last sequence changes 2008-10-24 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2014-08-05 (Christophe Dunand)
Peroxidase information: SbRboh (Sobic.001G303600.1[2.1] / Sb01g029540[1.4])
Name (synonym) SbRboh (Sobic.001G303600.1[2.1] / Sb01g029540[1.4])
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation N/D
Tissue types Callus
Cell culture
Embryos
Leaves
Roots
Inducer Oxidative stress
Repressor N/D
Best BLASTp hits
Perox score E-value SbRboh
start..stop
S start..stop
ZmRboh01 1267 0 14..677 1..666
EgrRboh07 778 0 48..677 156..796
MtRboh06 772 0 59..677 182..815
CsRboh07 751 0 43..677 160..784
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 51573275..51573403 129 N° 2 51574081..51574173 93 N° 3 51574254..51574364 111 N° 4 51574544..51574924 381
N° 5 51575048..51575434 387 N° 6 51575519..51575614 96 N° 7 51575716..51575831 116 N° 8 51575970..51576072 103
N° 9 51576213..51576380 168 N° 10 51576466..51576597 132 N° 11 51576688..51576816 129 N° 12 51576926..51577004 79
N° 13 51577337..51577446 110  
join(51573275..51573403,51574081..51574173,51574254..51574364,51574544..51574924 ,51575048..51575434,51575519..51575614,51575716..51575831,51575970..51576072,515 76213..51576380,51576466..51576597,51576688..51576816,51576926..51577004,5157733 7..51577446)


exon

Literature and cross-references SbRboh (Sobic.001G303600.1[2.1] / Sb01g029540[1.4])
Literature Cordonnier-Pratt,M.-M. et al., unpublished
DNA ref. Phytozome 11:   chromosome_1 (51573275..51577446)
Protein sequence: SbRboh (Sobic.001G303600.1[2.1] / Sb01g029540[1.4])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   677
PWM (Da):   %s   76858.87 Transmb domain:   %s   o152-171i234-256o289-311i336-358o368-385i502-519o
PI (pH):   %s   9.8
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDRGGEGVGVRGGRWVRLEPAVTDPKSPALMLRGTKIAAAVARYADQPEMFTQAYLCSCDRNSTSRITEKHIKQAIMFSASLNKLTLNQDEATEYTNLILEELQTGQGVIQMNVMRKGLSRDLQPTCWAIPLPIKCSQQILTATIVFFQAQWRRIFVVFLWLMACAALFTWKFMQYRQRLAFEVMGYCLSTAKGAAETLKLNMAIVLLPVCRNTVTWLRRSRVINSAIPFNDNINFHKLVAAGIVIGIILHGGIHLACDFPRIARAEKTFFGRTIASDFGYHQPSYLEIVASTEGITGIAMVVLMLIAFLLASSPWRRNPGTLPPLVRQFAGFNSFWYSHHVFIAVYVLLIVHSMFLFLAKDVAEKTTWMYVAIPVVIYVGERFYRMVRSMVFDVKILNATTYPGKVLALKVTKPPGFQYRSGMYVFVQCPEVSKFEWHPFSLTSAPDDDHLSIHIRSLGDWSYQMYNVFQALLSSNSSLPKILFDGPYGAASQDHSKYEIILLIGLGIGATPFISVLKDIANGLDKGHGSLNYHSDRLKKAYFYWVTREQGSFEWFRDIMKEVSVLDSKQGVIEMYNYLTSVYQEGDKRSMLISVIQALHFARHGIDIISKTPVRTHFSRPNWPRVLHGLARRHIGERIGVFYCGPDDLGRQLEKLCHKVNMRTFTRFVFHKEHF

Retrieve as FASTA  
Remarks Complete genomic (chromo 1, 11 introns). No EST. Predicted with softberry but shorter 5' than the other RboH.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATAGAGGCGGCGAGGGCGTAGGTGTCCGCGGTGGCCGGTGGGTGCGGCTAGAGCCTGCGGTCACCGACCCGAAATCCCCAGCCTTGATGTTGCGTGGGACCAAGATTGCTGCTGCC
GTCGCTAGG
GTCAAGCACGGCGAGTCGCCGGCTTCTGCGGTTCTGCCCCCTCTCCCTAGTCCCTAGTCCCTGTCGCCGCGCCATCCCTCTCCTCGCCGTTGACGACGACGAGCGCCACTA
GGGACTGACCTTTGATCGAGGAAGTGGCGGCTACTGCTGGGTCTAGCTGGGGCAGCGGACATCTCTCCGGCGGGGGTAGGTGGAGGCGTGGAGCAGGGGGCACGGGAAGAGAGTACGCAG
CCGCCTGTTTTTACTGGCGCCTTGTTTAGTTCACCCAAAAAGCAAAAAGTTTTTAAGATTCCCGTCACATCGAATCTTGCGGCACATGCATGAAGCATTAAATATAAATGAAAGCAAAAA
CTAATTACACAGTTTACCTGGAAATCGCGAGACGAATCTTTTGATCCTAGTTAGTCCATAATTGGATAATATTTGTCACAAACAAACGAAAGTGCTATAGTACCGAAATCCGAAATCTTT
TCGGAACTAAACAAGGCCTGGATCTTCATTCAAACAATTTACTTGCTTCTGTAGGTGAGAGTGAATCTAACAGTTCATCCGTATATCCTCTCCCGGTCAATCTAAATATCAACTCCAGTA
GGTCGATCGGTCGATCTCCTAGTCATGGCATCAGAATAGCAATGGATAGGTATTCTTCCTGAACTGTGATCCCCAACTCTTTACAGTACGCTGATCAACCAGAAATGTTTACACAAGCAT
ATCTTTGCAGCTGCGACAGAAACTCAACTAGCAGAATCACAGAAAAGCATATTAAGCAG
GTAGAAGTCATCTATGATGAAAATTTACTTGTTATTGTTGTGAGCCTAACACGTCTCCATA
TGTGCTTGTAATTTACCAGGCAATTATGTTCAGTGCCTCTCTGAACAAGCTCACATTAAACCAAGATGAGGCCACTGAATACACAAACTTGATCCTAGAAGAGCTCCAGACAGGCCAAGG
AGTCATTCAG
GTGACTTCCTAGTAATTTAAAACAAACAGTTCTTCATGCATAACCATGTATAATTATGCTACTATCATCATTATGTCGGTACGGAACCCCATGTTAGTAAATACAATTGA
TGGCATATACAAAAGTTTGGAATTTGGTGATAGCAAATTAAGACGTGTGTCTTCAAATTCAATTTACAGATGAATGTCATGAGGAAGGGCCTGTCAAGGGATCTCCAACCAACTTGCTGG
GCAATACCATTGCCAATAAAATGCAGCCAACAGATACTAACTGCAACCATAGTCTTCTTCCAAGCTCAATGGAGGCGTATATTTGTGGTTTTCTTGTGGCTCATGGCATGTGCTGCACTC
TTCACATGGAAGTTCATGCAGTATAGACAGCGGTTGGCTTTTGAGGTAATGGGGTACTGCCTGTCGACGGCCAAGGGGGCCGCAGAGACACTCAAGCTCAACATGGCCATTGTGCTCCTA
CCTGTTTGCCGCAACACAGTCACTTGGCTCAGGAGAAGCCGTGTTATCAACTCGGCCATCCCATTTAATGACAACATTAACTTCCACAAG
GTGTGTGTGTGTGTGTGTGTGTGTGTGTGT
GTGTGTGTGTGTGTGTGTAATCCTTTTTCAACTGTGTTGTGTCATGCTTTACTGGTCTGATGATCTGAGTTTAACGCTCATCTTTTAATTTAGCTTGTTGCGGCGGGTATTGTGATCGGT
ATAATCCTTCATGGAGGCATCCACCTGGCATGTGACTTCCCAAGGATTGCAAGAGCAGAAAAGACCTTCTTTGGACGTACAATTGCTTCTGACTTTGGGTACCACCAGCCATCCTACCTG
GAGATAGTGGCATCAACCGAGGGGATAACTGGTATAGCAATGGTGGTCCTAATGTTGATCGCATTCTTGCTTGCTAGTAGTCCTTGGAGAAGGAATCCAGGAACGCTGCCGCCTCTTGTC
AGACAGTTTGCTGGGTTCAATTCCTTCTGGTACTCACACCATGTGTTCATTGCCGTCTATGTTCTCCTCATCGTGCATTCCATGTTCCTCTTCCTAGCAAAGGATGTCGCAGAGAAGACG
GTAATATAATACTGCTCATTAAATAAATAAATCAAGCTCAGTATGCTTATGCCCCTCTGATTGCCACAAAAATGCATGTATCAGACATGGATGTATGTCGCAATTCCTGTGGTGATCTAC
GTTGGAGAACGATTCTACAGGATGGTCAGATCTATGGTGTTTGATGTCAAGATCCTCAAT
GTGTGATAATCTGCAACAAATACTATTTTTTTCAATGAAAATATGAGCTGTTATGTCAAT
TCAATCTTAGTTTTGTTTTTTCGTTTTCTGTTCCTTTACAGGCAACAACTTATCCAGGGAAGGTACTTGCCCTCAAGGTGACAAAGCCTCCAGGTTTTCAATATCGAAGTGGAATGTATG
TATTTGTCCAATGTCCAGAAGTATCAAAGTTTGAATG
GTGAGAAGATAGATCGCTACTGATTATATAGTCACTGTGTGCTGCACCAATGTTTAGTTAATTTCCTGCTGTCACTTGAATGA
AATGCATCCTTCTTACCTCTACTAATTCTAGATTTACTTTATCAAACTGTCTCAGGCACCCATTTTCCCTTACATCTGCTCCAGATGATGATCACTTGAGCATCCACATAAGATCTCTTG
GTGATTGGAGCTACCAAATGTATAATGTCTTCCAACAG
GTAAAGCACCAGTTCTTTACCCACTCTTCAATGAAACAACTATTTTTTTTTCTCAGACACTCTTGAAACAATAATTATTCAT
AATGCTATTATTTGCAAGTTTACAGTGATACTTAAAATATATGTTTTGAGGTTTGTAGGCACTGCTTTCCAGCAACTCCAGCCTGCCCAAAATATTATTTGATGGTCCCTACGGTGCAGC
ATCACAGGATCACTCCAAATATGAAATTATCTTGTTAATTGGGCTTGGAATAGGAGCAACGCCTTTCATAAGTGTTCTTAAAGACATTGCCAATGGATTAGATAAG
GTAATGACTGCACC
TGCATGGTATGTAATTTCATATACTTCTATCAGCTGAAGATTTATCATATTTATTATCTGAACTATCTCAGGGACATGGCAGCCTAAATTATCACTCCGACCGACTGAAGAAGGCCTACT
TTTATTGGGTGACAAGAGAGCAGGGATCCTTTGAGTGGTTCAGGGATATCATGAAAGAGGTTTCAGTTCTAGATAGCAAGCAG
GTTCACTTTTATAACCACTTTAATTAAACAGCGACCA
TATCTTCTTCAGAAATAGTACTCCATGTGACCACATCACTCATGTGCTTGTAGGGTGTGATAGAAATGTATAACTATCTGACAAGTGTCTACCAAGAAGGTGATAAGCGGTCGATGCTAA
TAAGTGTGATTCAAGCACTTCATTTTGCACGCCATGGCATTGATATCATCTCTAAAACTCCG
GTAAGTGTATCTACTTTCCAAGGCAACTACGCATGACAAGTGTCATATATGCGCCTAA
TATCTTTGATTGTAGAATGTGGAACGTTAAACAGAGTTGTTCAATTTGTAGGTTCGTACGCACTTTTCGAGGCCAAACTGGCCTAGAGTGCTCCATGGTCTTGCAAGAAGGCATATCGGG
GAGAGGATAG
GTAAGAGTACTGTCTTGTTCATGCCTAGAAACTAAGTATTTCCCTGCCTGAAAATGGAATGAAACTTAGAGATGAGGAAGGCAAATAAAGTGCATTCTTTATCTATTTAG
TGACTTTGTTTGGCCGTAACGTTTCAAGTATAATTGCTAGTCCGTTACATGCCAATATTCTCATTCATCTTCATGTCCCAAGGAGCTGCAGAAATTTGCTCCTACCCACTCAGCAATTTT
CTTATTCTGTAATCTGTATTAGGGCAACCTAGCAAAAGAAGCTTATAAGAAGAAACATTTGCTTCTGTGTTCCTCCTAAATTGAGCTTGAATGCATTGACAGGGGTTTTCTACTGTGGTC
CAGACGATTTGGGAAGACAACTGGAGAAGCTCTGCCACAAAGTGAATATGAGAACATTCACGAGATTTGTGTTCCACAAGGAACATTTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATAGAGGCGGCGAGGGCGTAGGTGTCCGCGGTGGCCGGTGGGTGCGGCTAGAGCCTGCGGTCACCGACCCGAAATCCCCAGCCTTGATGTTGCGTGGGACCAAGATTGCTGCTGCC
GTCGCTAGG
TACGCTGATCAACCAGAAATGTTTACACAAGCATATCTTTGCAGCTGCGACAGAAACTCAACTAGCAGAATCACAGAAAAGCATATTAAGCAGGCAATTATGTTCAGTGCC
TCTCTGAACAAGCTCACATTAAACCAAGATGAGGCCACTGAATACACAAACTTGATCCTAGAAGAGCTCCAGACAGGCCAAGGAGTCATTCAG
ATGAATGTCATGAGGAAGGGCCTGTCA
AGGGATCTCCAACCAACTTGCTGGGCAATACCATTGCCAATAAAATGCAGCCAACAGATACTAACTGCAACCATAGTCTTCTTCCAAGCTCAATGGAGGCGTATATTTGTGGTTTTCTTG
TGGCTCATGGCATGTGCTGCACTCTTCACATGGAAGTTCATGCAGTATAGACAGCGGTTGGCTTTTGAGGTAATGGGGTACTGCCTGTCGACGGCCAAGGGGGCCGCAGAGACACTCAAG
CTCAACATGGCCATTGTGCTCCTACCTGTTTGCCGCAACACAGTCACTTGGCTCAGGAGAAGCCGTGTTATCAACTCGGCCATCCCATTTAATGACAACATTAACTTCCACAAG
CTTGTT
GCGGCGGGTATTGTGATCGGTATAATCCTTCATGGAGGCATCCACCTGGCATGTGACTTCCCAAGGATTGCAAGAGCAGAAAAGACCTTCTTTGGACGTACAATTGCTTCTGACTTTGGG
TACCACCAGCCATCCTACCTGGAGATAGTGGCATCAACCGAGGGGATAACTGGTATAGCAATGGTGGTCCTAATGTTGATCGCATTCTTGCTTGCTAGTAGTCCTTGGAGAAGGAATCCA
GGAACGCTGCCGCCTCTTGTCAGACAGTTTGCTGGGTTCAATTCCTTCTGGTACTCACACCATGTGTTCATTGCCGTCTATGTTCTCCTCATCGTGCATTCCATGTTCCTCTTCCTAGCA
AAGGATGTCGCAGAGAAGACG
ACATGGATGTATGTCGCAATTCCTGTGGTGATCTACGTTGGAGAACGATTCTACAGGATGGTCAGATCTATGGTGTTTGATGTCAAGATCCTCAATGCA
ACAACTTATCCAGGGAAGGTACTTGCCCTCAAGGTGACAAAGCCTCCAGGTTTTCAATATCGAAGTGGAATGTATGTATTTGTCCAATGTCCAGAAGTATCAAAGTTTGAATG
GCACCCA
TTTTCCCTTACATCTGCTCCAGATGATGATCACTTGAGCATCCACATAAGATCTCTTGGTGATTGGAGCTACCAAATGTATAATGTCTTCCAACAG
GCACTGCTTTCCAGCAACTCCAGC
CTGCCCAAAATATTATTTGATGGTCCCTACGGTGCAGCATCACAGGATCACTCCAAATATGAAATTATCTTGTTAATTGGGCTTGGAATAGGAGCAACGCCTTTCATAAGTGTTCTTAAA
GACATTGCCAATGGATTAGATAAG
GGACATGGCAGCCTAAATTATCACTCCGACCGACTGAAGAAGGCCTACTTTTATTGGGTGACAAGAGAGCAGGGATCCTTTGAGTGGTTCAGGGAT
ATCATGAAAGAGGTTTCAGTTCTAGATAGCAAGCAG
GGTGTGATAGAAATGTATAACTATCTGACAAGTGTCTACCAAGAAGGTGATAAGCGGTCGATGCTAATAAGTGTGATTCAAGCA
CTTCATTTTGCACGCCATGGCATTGATATCATCTCTAAAACTCCG
GTTCGTACGCACTTTTCGAGGCCAAACTGGCCTAGAGTGCTCCATGGTCTTGCAAGAAGGCATATCGGGGAGAGG
ATAG
GGGTTTTCTACTGTGGTCCAGACGATTTGGGAAGACAACTGGAGAAGCTCTGCCACAAAGTGAATATGAGAACATTCACGAGATTTGTGTTCCACAAGGAACATTTCTAA

Retrieve as FASTA