Entry information : CsPrx02 (orange1.1g016209m/Cs1g15010)
Entry ID 8892
Creation 2011-07-01 (Qiang Li)
Last sequence changes 2012-01-04 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-30 (Qiang Li)
Peroxidase information: CsPrx02 (orange1.1g016209m/Cs1g15010)
Name (synonym) CsPrx02 (orange1.1g016209m/Cs1g15010)
Class Class III peroxidase    [Orthogroup: Prx022]
Taxonomy Eukaryota Viridiplantae Streptophyta Rutaceae Citrus
Organism Citrus sinensis    [TaxId: 2711 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CsPrx02
start..stop
S start..stop
CclPrx09 565 0 1..286 1..286
CclPrx09 193 1e-57 286..379 371..464
PtPrx19 481 6e-172 64..379 4..317
PtPrx61 475 9e-170 69..379 5..315
VvPrx95 466 2e-165 2..377 10..366
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 90528..90896 369 N° 2 91418..91606 189 N° 3 91702..91867 166 N° 4 92518..92662 145
N° 5 93442..93712 271  
join(90528..90896,91418..91606,91702..91867,92518..92662,93442..93712)


exon

Literature and cross-references CsPrx02 (orange1.1g016209m/Cs1g15010)
DNA ref. Citrus sinensis Annotation Project:   chr1 (18294080..18297330) Phytozome 12:   scaffold00096 (90528..93712)
Protein sequence: CsPrx02 (orange1.1g016209m/Cs1g15010)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   379 (356)
PWM (Da):   %s   41666.82 (38956.4)  
PI (pH):   %s   5.14 (4.84) Peptide Signal:   %s   cut: 24 range:24-379
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MMRRVSFLVFLLCIVISFKNQNADTKKGLNITTTSTTSRSFSYEYAASDPSAFQVVAGALFLSDDGKLEEGGEPYRSMEYDFYRDSCPQAEGTIRAMVRYLHKSRSDVAPALLRLVFHDCFIEGCDASILLDDAEGVDSEKKSPPNESLKGYDVINIIKEELEEICPGVVSCADILALAAREGVVLAGGPFYPLYTGRKDSRLAFADIATLELPSPNADLSETLASFASRGFDLRETVTLLGAHSIGVIHCKFFNNRLHNFGRSNEPDPSLDPDFLNLLRSKCRNISSTSDEPGINVTYDGHQGGFGTVYYRSLLQNRGVLYADQQLMAGEETGIWVRAYASDVSLFRRDFALAMMKLSNLRVLTGPMGQIRLNCSKGA

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATGCGAAGGGTGAGCTTCCTCGTGTTCCTTCTGTGCATCGTGATCTCTTTCAAGAACCAAAACGCCGATACCAAGAAAGGCTTAAACATCACCACTACGAGCACTACCTCGCGTTCT
TTTTCTTATGAGTATGCGGCGTCGGATCCTTCTGCGTTTCAGGTAGTGGCTGGGGCCCTGTTCTTGTCCGATGACGGGAAACTTGAAGAAGGTGGCGAGCCTTACCGTTCTATGGAGTAC
GATTTTTACCGCGATTCTTGCCCGCAAGCCGAGGGTACTATTCGGGCTATGGTCCGGTATCTCCACAAATCCCGCTCCGATGTCGCCCCCGCTTTGTTGCGCCTCGTTTTCCATGATTGC
TTCATTGAG
GTCCAGTTTTCTTCAATCAATTCTTGTTGTGTTTTTTATTGGTTTTAGTGCTAAGCGTTTCATTTCTTGTTGGATATCAACCTAATCGGATGTTGATTTTGATGTGAATTT
ATTATATCTTGATACTTGATCTTTACTATAATGTTGGTGAATATCTCATCGGACATCGAGTTTGATCAGTGTTTGGTTATTTGATTTTGATGTGAATTTGTTGAACCTTGGATATTTAAT
CTGGGATTTGTTGAATTTTGTAGTTCGTTTGCTTCTTGTTATTTTCCATATAATTTACTAGCTCTTTGCTAGTTGGATCTGGGTCATTGATTACTTAGTTTCATCCACTGTTATACAATC
TCCAAACAATCTAGTTTATTCTGATAATCTTTCAGTAGGGTTCTCTGATTTATTCACATTTTGATCTGGGTTTAGCAATTATCTAATGCGTATTTTTGTTGATTGGGTTGTTCTTACGTC
AGTCTGATTGATTTTGAGTTGAATTTCTCTGTAATTTGGAAATTGATTAGGGTTGTGATGCTTCAATTCTACTGGATGATGCTGAAGGAGTGGACTCGGAGAAAAAGTCTCCACCCAATG
AATCTCTCAAGGGCTACGATGTAATCAACATAATCAAGGAGGAGCTTGAAGAAATATGCCCTGGTGTGGTTTCATGTGCAGATATTCTTGCTTTGGCTGCCAGAGAAGGCGTTGTTCTG
G
TAAATTCCTGTCTCATGTGACTACTCAAACTTTATTAAATCAGGCTCTACCTTTATATAATTTGTTTAGATAATCATTTTGTCCATGAATTTAGGCTGGTGGTCCATTCTATCCACTGTA
TACTGGAAGGAAGGACAGTAGGCTTGCTTTCGCGGATATAGCAACACTTGAGCTTCCTTCACCCAATGCTGATCTGTCCGAAACCCTTGCATCTTTTGCATCAAGGGGGTTTGATTTAAG
AGAAACTGTTACTCTATTGG
GTATAGATTTCCTTATTTCATTTCATTTCCCTTTTTCCTTTCATGAAAAAGCAGAAATTTCTGATTTCAGTTTGTATTGAATTACTCTTGCAATTTTATT
TATTTTTGGTTATTTCTGCGTTTGAGCTGATTGTCTGATAGTCTTGTTCTGATCTCTTTTGTTCATAATTTGATGTACGGGAGAGGACAATATTTCCGCCTAATTCTACAGTTTAGCTTA
GTAGAGGTGTCTTATTTCCCTTCTCATTTGTACTACCTTTTATTTCCTATTCCTTGGTACTCAAATTAGAATATTCTTATCATTATCAATCCTTCATTATGTTATGATACGGATGGTAAT
ACCTTACACCTAGTATGATGACTTTTCTCTTAGAATGTATTGATTGGTCCTTGATTGGCGAATTCGTACTACAGATTATTCCTTTCTACCTAACAGTTTGTGCTTGTGATAACCTGATCC
GAGTATTTAATTTCATAAATATTCAAGGAAATTTGTTCAGAGATTTCTTAGATTCCAAACCTTGTTATGGTTCAGTTTTATGATGATAACCAGTTTTGATCTGTGATTGTGGTCGTTTCC
AGCCTCCTAGCTGTTTAAATGTCTATTCTAAGTAATGTAATTTGATTATTTCTCCTTTCTTTGTTTGCAGGTGCCCATAGCATTGGTGTTATCCACTGCAAATTCTTCAACAATCGTCTG
CATAACTTCGGCCGGAGTAATGAACCTGACCCATCTCTGGATCCTGATTTTCTGAACCTACTGAGATCAAAATGCAGAAACATTTCATCAACATC
GCCAACACCCTCACCTCCCTATGTT
GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTCCCCATCATCATCGGCAGCTCCATCAGCTGACTTTGATGGCTCAGTTTCTTCTTCATCAGCTCCCTCACCTA
ACTTCGATGGCTCATTTTCCTCATCAGCAGCTCCATCACCAAACTTCAATGGCTCACCAAAATCAACAACAGCTTTATCACCTGCCTTTGATGCCTCACCCTCATCACCCACAGCATCAA
TATTTTCGTTGGAGGCCTTGTTAGCTTCAACATTTGACGAACCTGGAATAAATGTGACTTATGATGGACATCAAGGAGGATTCGGCACTGTGTACTATCGCAGTCTTTTGCAGAATAGAG
GAGTTCTCTACGCTGATCAGCAGCTTATGGCCGGCGAAGAAACTGGGATCTGGGTGAGAGCATATGCTTCAGATGTCTCCTTGTTTCGCAGAGACTTTGCCTTGGCCATGATGAAGCTCT
CAAATCTCCGAGTCTTGACAGGACCAATGGGCCAGATCCGTCTTAATTGTTCAAAGGGGGCATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATGCGAAGGGTGAGCTTCCTCGTGTTCCTTCTGTGCATCGTGATCTCTTTCAAGAACCAAAACGCCGATACCAAGAAAGGCTTAAACATCACCACTACGAGCACTACCTCGCGTTCT
TTTTCTTATGAGTATGCGGCGTCGGATCCTTCTGCGTTTCAGGTAGTGGCTGGGGCCCTGTTCTTGTCCGATGACGGGAAACTTGAAGAAGGTGGCGAGCCTTACCGTTCTATGGAGTAC
GATTTTTACCGCGATTCTTGCCCGCAAGCCGAGGGTACTATTCGGGCTATGGTCCGGTATCTCCACAAATCCCGCTCCGATGTCGCCCCCGCTTTGTTGCGCCTCGTTTTCCATGATTGC
TTCATTGAG
GGTTGTGATGCTTCAATTCTACTGGATGATGCTGAAGGAGTGGACTCGGAGAAAAAGTCTCCACCCAATGAATCTCTCAAGGGCTACGATGTAATCAACATAATCAAGGAG
GAGCTTGAAGAAATATGCCCTGGTGTGGTTTCATGTGCAGATATTCTTGCTTTGGCTGCCAGAGAAGGCGTTGTTCTG
GCTGGTGGTCCATTCTATCCACTGTATACTGGAAGGAAGGAC
AGTAGGCTTGCTTTCGCGGATATAGCAACACTTGAGCTTCCTTCACCCAATGCTGATCTGTCCGAAACCCTTGCATCTTTTGCATCAAGGGGGTTTGATTTAAGAGAAACTGTTACTCTA
TTGG
GTGCCCATAGCATTGGTGTTATCCACTGCAAATTCTTCAACAATCGTCTGCATAACTTCGGCCGGAGTAATGAACCTGACCCATCTCTGGATCCTGATTTTCTGAACCTACTGAGA
TCAAAATGCAGAAACATTTCATCAACATC
TGACGAACCTGGAATAAATGTGACTTATGATGGACATCAAGGAGGATTCGGCACTGTGTACTATCGCAGTCTTTTGCAGAATAGAGGAGTT
CTCTACGCTGATCAGCAGCTTATGGCCGGCGAAGAAACTGGGATCTGGGTGAGAGCATATGCTTCAGATGTCTCCTTGTTTCGCAGAGACTTTGCCTTGGCCATGATGAAGCTCTCAAAT
CTCCGAGTCTTGACAGGACCAATGGGCCAGATCCGTCTTAATTGTTCAAAGGGGGCATAA

Retrieve as FASTA