Entry information : AruPrx01-2 (HRPC1B / HRPC1B / HRPC2 / HRP_15901)
Entry ID 89
Creation 2006-09-05 (Christophe Dunand)
Last sequence changes 2014-06-12 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2014-06-12 (Christophe Dunand)
Peroxidase information: AruPrx01-2 (HRPC1B / HRPC1B / HRPC2 / HRP_15901)
Name (synonym) AruPrx01-2 (HRPC1B / HRPC1B / HRPC2 / HRP_15901)
Class Class III peroxidase    [Orthogroup: Prx035]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Armoracia
Organism Armoracia rusticana (horseradish)    [TaxId: 3704 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AruPrx01-2
start..stop
S start..stop
AruPrx01-3 676 0 1..351 1..352
AlyPrx33 646 0 7..351 4..349
BstrPrx51 640 0 13..351 16..354
AhalPrx39 640 0 11..351 14..355
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 31..255 225 N° 2 1091..1282 192 N° 3 1711..1879 169 N° 4 1971..2440 470
join(31..255,1091..1282,1711..1879,1971..2440)


exon

Literature and cross-references AruPrx01-2 (HRPC1B / HRPC1B / HRPC2 / HRP_15901)
Literature REFERENCE 1 Fujiyama,K. et al. Structure of the horseradish peroxidase isozyme C genes
REFERENCE 2 Naatsaari,L., Krainer,F.W., Schubert,M., Glieder,A. and Thallinger,G.G. Peroxidase gene discovery from the horseradish transcriptome. BMC Genomics 15 (1), 227 (2014)
Protein ref. UniProtKB:   K7ZW26   P15232
DNA ref. GenBank:   HE963801.1   M37157
Protein sequence: AruPrx01-2 (HRPC1B / HRPC1B / HRPC2 / HRP_15901)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   351 (323)
PWM (Da):   %s   38490.42 (35490.0) Transmb domain:   %s   i7-26o
PI (pH):   %s   6.02 (6.12) Peptide Signal:   %s   cut: 29 range:29-351
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MHSPSSTSFTWILITLGCLAFYASLSDAQLTPTFYDTSCPNVSNIVRDIIINELRSDPRITASILRLHFHDCFVNGCDASILLDNTTSFLTEKDALGNANSARGFPTVDRIKAAVERACPRTVSCADVLTIAAQQSVNLAGGPSWRVPLGRRDSLQAFLDLANANLPAPFFTLPQLKDAFAKVGLDRPSDLVALSGGHTFGKNQCRFIMDRLYNFSNTGLPDPTLNTTYLQTLRQQCPLNGNQSVLVDFDLRTPTVFDNKYYVNLKEQKGLIQSDQELFSSPNATDTIPLVRSFADGTQKFFNAFVEAMNRMGNITPLTGTQGEIRLNCRVVNSNSLLHDIVEVVDFVSSM

Retrieve as FASTA  
Remarks Complete sequence from DNA (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATTCCCCTTCTTCTACTTCGTTTACTTGGATCTTAATCACATTGGGATGTCTTGCGTTTTATGCGTCTTTGTCCGATGCTCAGCTTACCCCTACCTTCTACGACACTTCATGTCCT
AATGTCTCAAACATCGTACGAGACATCATTATTAATGAGCTACGATCGGACCCTCGTATCACCGCGAGTATCCTTCGTCTTCACTTCCACGACTGCTTTGTTAAT
GTAAGATAATACTTT
TTCATATTTCTATTGCGTTATGAATTATTGTGCGTTTTATCCTTTAGATATTGATAAATCACCTCAAGTCAAAATTTAATAAAACATTAAATAAAATATGATACAAAGAGTCAATTTGTT
TTGTAGGAATATAATAGAAATTTCAACATGTTTTTAAATATGGGTCCAAAATGTTGAAAACGACATTTCTTATGAAAAAGAGTGAGTATGTATTAAATCATAATTTGCTATAATTATCGG
GTTGTGAAAGTAGTTCTATTCATTTTGACATGTAGATGGTTGCATAGTACGTTTTGTCTACAACATTTTTTTCTTGATTCATTTTACAAAATTACAAGTTCACTTGCCTCCGAAAAATAT
GTATAGCCTTACTATGACATAATTACATAATTTACATTCAATAATAATTTTTATTTTTTATATAATAATTTTTATTTTTATTTATATAAAAAAGAAAGATATTATTGTTTGTGGTGTCAG
TTGGGTGAAATCGTATCCTAAATAAAAGTCACTCGAGTAACGGTTCTGATCCAGATTAAAAAATCAGTACCAAATTTCACATGGTTAGATGTCGTGTGTTAGATTTTGCTGTTGAATAAT
TAAATACTTAACTCTCGTCGACAATGATAATGCTAAAATATTTATGAAATCGGATTCACGCCCGTGTTACAGTATTAAGAGCATGGTGCCGTACCAAACACGATACGAATTTAATGGTGA
CAAAAAATCTCTGTTAAATTGTTACCGGTGGTAAAGAGTTAGCTATGGATGTAATACATGTACTAATAATTTGTTAATTAATATTTTGGATGTTTGAAAGGGTTGTGACGCATCGATATT
GTTAGACAACACAACATCATTTCTAACAGAGAAAGATGCGCTTGGAAACGCAAACTCGGCTAGAGGATTTCCTACAGTTGACAGAATCAAGGCCGCGGTGGAGAGGGCATGCCCAAGAAC
AGTTTCATGCGCAGATGTGCTTACCATTGCAGCTCAACAATCTGTTAATTTG
GTATGCTCCATTCATTACAAACATTGTTTTTTAATTTTAACATATTTTTTAGTTGTTTGAGAGCGTCA
CAATCTATATTTAGTATCAACAACTGTTCGACTATATGAGGTATTCATGGATTAATCGAGAAATATTCAAAACGCGTGGTCCCGTTAAGAAAATTTGACAAGTTTAATATCATTGGAAAA
ATTAGGTCTCATCACAAGGTTTTACCTTGGTAGGCAAAGCTACTTTATAATTAACCAAAAAGGATAATTTTCATTTTTTCCAAAAATAGTGGAGATAAAACAAACTCCACTTTGAGTATA
TCATCAATCAATTTATACTACATGTTTATCTTTTTCTCTTTACATATTGAAACTTCCGAGTGACAAATTAATCTCACAAAAATAATTATTTTGAATATAATGGTTACTATTATATTATAG

GCAGGAGGTCCTTCTTGGAGGGTTCCTTTGGGAAGAAGAGACAGCTTACAAGCATTTTTAGATCTTGCTAATGCAAATCTTCCAGCTCCATTCTTTACACTTCCACAACTTAAGGATGCC
TTTGCAAAAGTTGGCCTCGACCGTCCTTCTGATCTCGTTGCTCTCTCCG
GTAGTTAACAAAAGAAAATTAAACACCATTTGATATAAGTTCAATTAGATATTTCATTATTGATCTTATTA
TATGGTCTTTCTTTTGTTAGGTGGTCACACATTTGGAAAAAATCAGTGTAGATTTATTATGGACAGATTATACAACTTCAGCAACACCGGACTACCCGACCCTACCCTCAACACTACTTA
CCTTCAAACTCTTCGTCAACAATGTCCCCTAAATGGAAACCAAAGTGTATTGGTGGATTTCGATCTGCGTACGCCAACGGTTTTCGATAACAAATACTATGTGAATCTTAAAGAGCAAAA
AGGTCTCATTCAGAGTGACCAAGAGTTGTTCTCTAGCCCCAATGCCACTGACACAATCCCCTTGGTGAGGTCATTTGCTGATGGCACACAAAAATTCTTCAATGCGTTTGTGGAGGCTAT
GAATAGGATGGGAAATATTACACCTCTTACAGGAACTCAAGGAGAAATCAGGTTGAATTGTAGGGTGGTGAACTCCAACTCTCTACTCCATGATATAGTGGAGGTCGTTGACTTTGTTAG
CTCTATGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATTCCCCTTCTTCTACTTCGTTTACTTGGATCTTAATCACATTGGGATGTCTTGCGTTTTATGCGTCTTTGTCCGATGCTCAGCTTACCCCTACCTTCTACGACACTTCATGTCCT
AATGTCTCAAACATCGTACGAGACATCATTATTAATGAGCTACGATCGGACCCTCGTATCACCGCGAGTATCCTTCGTCTTCACTTCCACGACTGCTTTGTTAAT
GGTTGTGACGCATCG
ATATTGTTAGACAACACAACATCATTTCTAACAGAGAAAGATGCGCTTGGAAACGCAAACTCGGCTAGAGGATTTCCTACAGTTGACAGAATCAAGGCCGCGGTGGAGAGGGCATGCCCA
AGAACAGTTTCATGCGCAGATGTGCTTACCATTGCAGCTCAACAATCTGTTAATTTG
GCAGGAGGTCCTTCTTGGAGGGTTCCTTTGGGAAGAAGAGACAGCTTACAAGCATTTTTAGAT
CTTGCTAATGCAAATCTTCCAGCTCCATTCTTTACACTTCCACAACTTAAGGATGCCTTTGCAAAAGTTGGCCTCGACCGTCCTTCTGATCTCGTTGCTCTCTCCG
GTGGTCACACATTT
GGAAAAAATCAGTGTAGATTTATTATGGACAGATTATACAACTTCAGCAACACCGGACTACCCGACCCTACCCTCAACACTACTTACCTTCAAACTCTTCGTCAACAATGTCCCCTAAAT
GGAAACCAAAGTGTATTGGTGGATTTCGATCTGCGTACGCCAACGGTTTTCGATAACAAATACTATGTGAATCTTAAAGAGCAAAAAGGTCTCATTCAGAGTGACCAAGAGTTGTTCTCT
AGCCCCAATGCCACTGACACAATCCCCTTGGTGAGGTCATTTGCTGATGGCACACAAAAATTCTTCAATGCGTTTGTGGAGGCTATGAATAGGATGGGAAATATTACACCTCTTACAGGA
ACTCAAGGAGAAATCAGGTTGAATTGTAGGGTGGTGAACTCCAACTCTCTACTCCATGATATAGTGGAGGTCGTTGACTTTGTTAGCTCTATGTGA

Retrieve as FASTA