Entry information : SbPrx51 (Sobic.003G050300.1 [2.1] / SB03G004380 [1.4])
Entry ID 890
Creation 2010-01-11 (Christophe Dunand)
Last sequence changes 2010-01-11 (Christophe Dunand)
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-08-04 (Messaoudi)
Peroxidase information: SbPrx51 (Sobic.003G050300.1 [2.1] / SB03G004380 [1.4])
Name (synonym) SbPrx51 (Sobic.003G050300.1 [2.1] / SB03G004380 [1.4])
Class Class III peroxidase    [Orthogroup: Prx006]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation N/D
Tissue type Seedlings
Inducer Dark growth
Repressor N/D
Best BLASTp hits
Perox score E-value SbPrx51
start..stop
S start..stop
SiPrx18 577 0 1..331 1..327
OsPrx01 555 0 1..331 1..326
BdiPrx50 550 0 1..331 1..326
LjPrx51 472 3e-169 6..331 1..322
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 4651116..4651337 222 N° 2 4650756..4650935 180 N° 3 4649998..4650591 594  
complement(join(4649998..4650591,4650756..4650935,4651116..4651337))


exon

Literature and cross-references SbPrx51 (Sobic.003G050300.1 [2.1] / SB03G004380 [1.4])
Literature Cordonnier-Pratt, M.-M. et al., unpublished.
DNA ref. Phytozome 12:   chromosome_3 (4651337..4649998)
EST ref. GenBank:   BE358463 [Fragment]
Cluster/Prediction ref. PlantGDB:   SbGSStuc11-12-04.4242.2
Protein sequence: SbPrx51 (Sobic.003G050300.1 [2.1] / SB03G004380 [1.4])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   331 (305)
PWM (Da):   %s   35136.66 (32379.1)  
PI (pH):   %s   6.5 (6.13) Peptide Signal:   %s   cut: 27 range:27-331
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAAPEMAALLLLSFTVILLRSSSVRSQGLQIGFYDSYCPDAEDIVRSTVEQYYDRDATIAPGLLRLHFHDCFVQGCDASVLISGSSSERSAPQNFGLRGFEVIDDAKSQLEAVCPGVVSCADILALAARDAVDLTGGPSWSVPLGRRDGRLSSASGANALPSPADPVSVQRKKFADQGLTDHDLVTLVGAHTIGQTDCQFFSYRLYNFTATGNADPTISQASLAQLRALCPPPSGGDPAGRRVALDQGSPGAFDVSFFKNVRDGGAVLESDQRLWSDAATQGVVQKYAGNVRGLFGLRFGYELPKAMVRMSSIGVKTGGQGEIRRRCSRVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic DNA (chromo 3, introns 1 and 3) and 1 EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGCACCAGAAATGGCAGCTCTTCTCCTGCTTTCGTTCACTGTTATACTGCTGAGAAGTTCCTCTGTTCGTAGTCAAGGACTGCAGATCGGGTTCTACGACTCCTACTGTCCTGAC
GCCGAGGATATCGTGAGGTCGACTGTCGAGCAGTACTACGACAGGGATGCCACCATCGCCCCAGGCTTGCTCAGGCTACACTTCCATGACTGCTTTGTTCAG
GCTAGTTATACATCTCTT
CTTTAAGCTACCACTTTGTGTTTCATCATCCTGTGGTGATGCAAATACACTGTCACTCTTACTCAAGTCTCAAGCTGCATATATAAACTAGCCTGAACAAATTTACAGGCTGCATAGTTT
GAGTTGAGTATGACAGTTGTTTTGCTGGCTTTTGCATTGCAGGGGTGCGACGCATCAGTCTTGATCTCTGGATCATCTTCAGAAAGGAGTGCACCACAGAATTTTGGGCTCAGGGGGTTT
GAGGTGATAGATGACGCCAAGTCCCAGCTAGAAGCCGTGTGCCCTGGGGTGGTGTCATGCGCTGATATCCTTGCTCTCGCCGCGCGTGACGCTGTTGATCTG
GTGAGAGTCAGTCCATGT
TAACTCAGCGAGAGCAGAGTCTTTTACATTCTGATTGAGGTCATGTCATGTTTGTTTTAACTGTTTTATTACTGAGAACTGATGATGAATTTACTGTTCTTCTGTCTTTTCTTGGGGTAA
ACAAATCCGTAAATGTAATGTAAAAGACTGGTGGGCCAAGCTGGTCAGTGCCGCTGGGGAGAAGAGACGGGAGACTCTCGTCAGCTTCTGGCGCCAACGCCTTGCCATCGCCTGCCGATC
CTGTATCCGTTCAGAGGAAGAAGTTCGCGGACCAGGGACTGACAGACCACGACCTCGTCACATTGGTAGGCGCTCACACGATCGGGCAGACCGATTGCCAGTTCTTCAGCTACCGGCTGT
ACAACTTCACGGCGACGGGCAACGCGGACCCGACCATCAGCCAGGCGTCGCTGGCGCAGCTCCGGGCGCTGTGCCCACCGCCCAGCGGCGGCGACCCGGCCGGGCGGCGGGTGGCGCTGG
ACCAGGGTAGCCCTGGCGCGTTCGACGTGAGCTTCTTCAAGAACGTCCGCGACGGCGGCGCGGTCCTGGAGTCGGACCAGCGGCTGTGGAGCGACGCCGCCACGCAGGGCGTGGTGCAGA
AGTACGCCGGCAATGTTCGGGGACTCTTCGGCCTCAGGTTCGGGTACGAGCTCCCCAAGGCCATGGTGAGGATGAGCAGCATCGGGGTGAAGACCGGCGGGCAGGGCGAGATCAGGAGGA
GGTGCTCCAGGGTCAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGCACCAGAAATGGCAGCTCTTCTCCTGCTTTCGTTCACTGTTATACTGCTGAGAAGTTCCTCTGTTCGTAGTCAAGGACTGCAGATCGGGTTCTACGACTCCTACTGTCCTGAC
GCCGAGGATATCGTGAGGTCGACTGTCGAGCAGTACTACGACAGGGATGCCACCATCGCCCCAGGCTTGCTCAGGCTACACTTCCATGACTGCTTTGTTCAG
GGGTGCGACGCATCAGTC
TTGATCTCTGGATCATCTTCAGAAAGGAGTGCACCACAGAATTTTGGGCTCAGGGGGTTTGAGGTGATAGATGACGCCAAGTCCCAGCTAGAAGCCGTGTGCCCTGGGGTGGTGTCATGC
GCTGATATCCTTGCTCTCGCCGCGCGTGACGCTGTTGATCTG
ACTGGTGGGCCAAGCTGGTCAGTGCCGCTGGGGAGAAGAGACGGGAGACTCTCGTCAGCTTCTGGCGCCAACGCCTTG
CCATCGCCTGCCGATCCTGTATCCGTTCAGAGGAAGAAGTTCGCGGACCAGGGACTGACAGACCACGACCTCGTCACATTGGTAGGCGCTCACACGATCGGGCAGACCGATTGCCAGTTC
TTCAGCTACCGGCTGTACAACTTCACGGCGACGGGCAACGCGGACCCGACCATCAGCCAGGCGTCGCTGGCGCAGCTCCGGGCGCTGTGCCCACCGCCCAGCGGCGGCGACCCGGCCGGG
CGGCGGGTGGCGCTGGACCAGGGTAGCCCTGGCGCGTTCGACGTGAGCTTCTTCAAGAACGTCCGCGACGGCGGCGCGGTCCTGGAGTCGGACCAGCGGCTGTGGAGCGACGCCGCCACG
CAGGGCGTGGTGCAGAAGTACGCCGGCAATGTTCGGGGACTCTTCGGCCTCAGGTTCGGGTACGAGCTCCCCAAGGCCATGGTGAGGATGAGCAGCATCGGGGTGAAGACCGGCGGGCAG
GGCGAGATCAGGAGGAGGTGCTCCAGGGTCAACTGA

Retrieve as FASTA