Entry information : CsPrx34 (orange1.1g019629m/Cs5g32270)
Entry ID 8900
Creation 2011-07-01 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2017-12-14 (Qiang Li)
Peroxidase information: CsPrx34 (orange1.1g019629m/Cs5g32270)
Name (synonym) CsPrx34 (orange1.1g019629m/Cs5g32270)
Class Class III peroxidase    [Orthogroup: Prx014]
Taxonomy Eukaryota Viridiplantae Streptophyta Rutaceae Citrus
Organism Citrus sinensis    [TaxId: 2711 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CsPrx34
start..stop
S start..stop
CclPrx03 698 0 1..338 1..338
CppPrx12 684 0 1..338 1..338
MePrx130 482 5e-173 10..328 5..322
RcPrx88 476 7e-171 9..329 3..322
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 5709155..5709376 222 N° 2 5709492..5709683 192 N° 3 5709919..5710087 169 N° 4 5710206..5710639 434
join(5709155..5709376,5709492..5709683,5709919..5710087,5710206..5710639)


exon

Literature and cross-references CsPrx34 (orange1.1g019629m/Cs5g32270)
DNA ref. Citrus sinensis Annotation Project:   chr5 (33624988..33626835) Phytozome 12:   scaffold00001 (5709155..5710639)
Protein sequence: CsPrx34 (orange1.1g019629m/Cs5g32270)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   339 (312)
PWM (Da):   %s   36972.74 (34331.3) Transmb domain:   %s   i7-29o
PI (pH):   %s   7.9 (7.41) Peptide Signal:   %s   cut: 27 range:27-338
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKKAAGAGSLLLVCLVVFGIIGVCQGGELRKNFYRDSCKSAEDIVRSITWKNAASNPDLPAKLIRMHFHDCFVRGCDASVLINSTAGNKAERDAVPNLSLGGFEVINEIKSELESRCPGIVSCADIVALATRDSVSFQFQKPDLWEVLTGRRDGSVSIAAEADLLLPSPFANFSELKKNFNDKGLTVKDLVVLSGGHTIGVSHCTFFSNRLYNFTGNGDQDPSLDPRYAAFLKTKCKSLADTTTTAELDPGSFRKFDSHYYDILIENKGLFQSDAALLTNKGARNIVMELRNQDKFFTEFAQSMKRMGAMNVLTGTQGEIRKKCSVINNPDSLLHSSI*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGAAAGCCGCTGGGGCTGGGTCTCTTTTGTTAGTTTGCTTAGTAGTTTTTGGTATTATAGGGGTTTGCCAAGGAGGTGAGCTAAGGAAGAATTTCTACAGGGACAGCTGTAAATCT
GCTGAAGATATCGTCAGGAGCATCACCTGGAAAAATGCCGCCAGTAACCCTGACTTGCCGGCCAAGCTTATCAGAATGCATTTCCATGACTGCTTTGTTAGG
GTAATTCAATACTACAGC
TAATTAGCTTCAACGTCAAAATTATTTGATCGATGCACGCGCGCTTCTATATTACATTGAGCCATCTAATTAGCTTGTGATTAACTTATTTCTGCAGGGTTGCGATGCGTCGGTTTTGAT
AAACTCAACTGCAGGTAACAAAGCAGAGAGGGATGCAGTTCCGAATCTATCTTTGGGAGGTTTCGAAGTTATTAATGAGATTAAATCGGAGCTCGAGAGCAGGTGTCCAGGAATTGTTTC
TTGTGCCGATATCGTAGCATTGGCTACAAGGGATTCTGTTTCATTCCAA
GTAAGTTTAGTTACGTTAATCAGCTAAATCTCCTTTGAACATGTGCGTGTGTATTGTACGTGTCTATGAAA
TCTTATTATGCGGATCAAGCTAAAAATAGACAAATACCAACTCTAATAATCTACTGAAAGGATGAAAAAACACTGCTTCATTTCCTTGTCTTTTTAGCTTGGTCATCAGTTTATTGAAAC
GACGGAGATTTGTCTATATGAATATTGTGCCATAACATTTGCAGTTTCAAAAACCGGACCTGTGGGAAGTGCTCACCGGTAGAAGAGATGGCAGTGTGTCCATAGCTGCTGAGGCCGATC
TGCTGCTTCCTTCACCTTTTGCCAACTTCAGTGAACTCAAGAAAAATTTTAACGACAAAGGTCTCACTGTCAAAGATCTTGTAGTCCTTTCAG
GTATGCATTNNNNNNNNNNNNNNNNNN
NNNNNNNNNACCAATTTTACAACTAATTTAAGTAAATAACAAAGATGTAACCATGCTTCACATCTAATTAATTTGCATTTATTAATCTAAGGTGGCCACACAATCGGAGTTTCGCACTGC
ACCTTCTTCAGCAACAGGCTCTACAATTTCACAGGAAATGGAGATCAAGATCCTTCATTGGACCCACGATACGCTGCATTCTTAAAAACCAAATGCAAGAGCCTTGCCGACACAACGACT
ACTGCCGAATTGGACCCGGGGAGTTTTCGAAAATTCGACAGCCATTACTATGATATTCTTATCGAGAACAAGGGTCTATTCCAATCTGATGCTGCTCTTTTAACCAATAAGGGAGCAAGA
AACATTGTCATGGAGTTGAGAAACCAAGATAAGTTCTTCACCGAGTTTGCTCAGTCAATGAAGAGAATGGGAGCTATGAATGTTCTCACTGGCACTCAAGGGGAGATTCGAAAGAAGTGC
AGTGTTATTAATAATCCAGATAGTTTGTTGCATTCATCTATCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGAAAGCCGCTGGGGCTGGGTCTCTTTTGTTAGTTTGCTTAGTAGTTTTTGGTATTATAGGGGTTTGCCAAGGAGGTGAGCTAAGGAAGAATTTCTACAGGGACAGCTGTAAATCT
GCTGAAGATATCGTCAGGAGCATCACCTGGAAAAATGCCGCCAGTAACCCTGACTTGCCGGCCAAGCTTATCAGAATGCATTTCCATGACTGCTTTGTTAGG
GGTTGCGATGCGTCGGTT
TTGATAAACTCAACTGCAGGTAACAAAGCAGAGAGGGATGCAGTTCCGAATCTATCTTTGGGAGGTTTCGAAGTTATTAATGAGATTAAATCGGAGCTCGAGAGCAGGTGTCCAGGAATT
GTTTCTTGTGCCGATATCGTAGCATTGGCTACAAGGGATTCTGTTTCATTCCAA
TTTCAAAAACCGGACCTGTGGGAAGTGCTCACCGGTAGAAGAGATGGCAGTGTGTCCATAGCTGCT
GAGGCCGATCTGCTGCTTCCTTCACCTTTTGCCAACTTCAGTGAACTCAAGAAAAATTTTAACGACAAAGGTCTCACTGTCAAAGATCTTGTAGTCCTTTCAG
GTGGCCACACAATCGGA
GTTTCGCACTGCACCTTCTTCAGCAACAGGCTCTACAATTTCACAGGAAATGGAGATCAAGATCCTTCATTGGACCCACGATACGCTGCATTCTTAAAAACCAAATGCAAGAGCCTTGCC
GACACAACGACTACTGCCGAATTGGACCCGGGGAGTTTTCGAAAATTCGACAGCCATTACTATGATATTCTTATCGAGAACAAGGGTCTATTCCAATCTGATGCTGCTCTTTTAACCAAT
AAGGGAGCAAGAAACATTGTCATGGAGTTGAGAAACCAAGATAAGTTCTTCACCGAGTTTGCTCAGTCAATGAAGAGAATGGGAGCTATGAATGTTCTCACTGGCACTCAAGGGGAGATT
CGAAAGAAGTGCAGTGTTATTAATAATCCAGATAGTTTGTTGCATTCATCTATCTGA

Retrieve as FASTA