Entry information : CsPrx39 (orange1.1g019972m/Cs7g06700)
Entry ID 8902
Creation 2011-07-01 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2017-12-14 (Qiang Li)
Peroxidase information: CsPrx39 (orange1.1g019972m/Cs7g06700)
Name (synonym) CsPrx39 (orange1.1g019972m/Cs7g06700)
Class Class III peroxidase    [Orthogroup: Prx030]
Taxonomy Eukaryota Viridiplantae Streptophyta Rutaceae Citrus
Organism Citrus sinensis    [TaxId: 2711 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CsPrx39
start..stop
S start..stop
CclPrx42 615 0 1..298 18..315
RcPrx44 525 0 17..333 12..327
PtPrx52 509 0 26..333 27..334
PtPrx79 503 0 18..333 17..332
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 816769..817008 240 N° 2 816459..816638 180 N° 3 816191..816356 166 N° 4 815680..816095 416
complement(join(815680..816095,816191..816356,816459..816638,816769..817008))


exon

Literature and cross-references CsPrx39 (orange1.1g019972m/Cs7g06700)
DNA ref. Citrus sinensis Annotation Project:   chr7 (3902735..3907712) Phytozome 12:   scaffold00025 (817008..815680)
Protein sequence: CsPrx39 (orange1.1g019972m/Cs7g06700)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   334 (300)
PWM (Da):   %s   36007.54 (32499.9)  
PI (pH):   %s   5.04 (4.81) Peptide Signal:   %s   cut: 34 range:34-333
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSSNPGIGSFCKANGYVLFVFVLFRLAASPCCASLSFNFYAASCPSAEFMVANTVRSASSFDRTIPGKLLRLLFHDCFVEGCDASVLLQGNGTERSDPANASLGGFEVIDSAKRVLEIFCPGTVSCADIIALAARDSVEIAGGPAIQIPTGRRDGRASAAENVRANIVDTTFTMNEMIKAFSSKGLSMDDLVTLSGAHTIGSAHCNAFNDRFREDPKGKLTLIDTSLDSSYANELMRKCPANASSSVTVNNDPETSFVFDNQYYRNLLAHKGLFQSDSVLLHDERTRKQVENFANDQESFFSNWGLSFLKVTSIGVKTEDEGEIRQTCSMTNG*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGTTCAAATCCAGGAATTGGTTCATTTTGTAAAGCTAATGGCTACGTACTTTTTGTTTTTGTTCTGTTCCGTCTTGCTGCTTCTCCTTGCTGTGCCAGCCTCTCTTTCAACTTCTAT
GCAGCTTCATGCCCCTCTGCTGAGTTCATGGTTGCAAACACGGTGAGATCAGCTTCCTCTTTTGATCGCACCATCCCCGGGAAGCTCCTCCGCCTGCTCTTCCATGACTGCTTCGTTGAG
GTAAGTGGTTCTTATCGAACAATTGCAATGTTGGAGTTCTCTTCCCAATAAATTTTAAAATCAAAGACTGATGTGGATATGTAGTAGTCATTGGAAACAAAAACCTGAAAACTTTCACCA
AAACCACCAGGGTTGTGATGCTTCTGTACTGCTACAAGGAAATGGGACAGAGCGAAGTGATCCAGCAAACGCATCTCTTGGAGGGTTTGAAGTTATTGATTCGGCGAAAAGAGTTCTTGA
AATCTTCTGTCCTGGGACTGTTTCTTGTGCTGATATTATTGCTTTGGCCGCTAGAGATTCTGTTGAAATA
GTAAGATTTTCCCCTCTCATTAGTTACTGCTTTGTGCTGCTACTGCTCAT
TTTTATTTCATGTTGGTTGGGTTTCTTTCCATTCACAAAGACTTGAAAACAGGCTGGTGGCCCGGCAATTCAAATTCCTACAGGCAGGAGGGATGGGAGAGCATCAGCAGCTGAAAACGT
TAGAGCCAACATTGTAGATACAACATTCACAATGAATGAGATGATAAAGGCCTTTTCCTCTAAAGGCTTGTCCATGGATGACCTCGTTACTCTATCAG
GTATATCTCAGGACACGTTTGT
AACTATTTTGCTTCTGCTTGATTTTAGAAAAATACAACATCTGAAAGTGTTTGATAAATTCCCACTTGAGCAGGAGCTCACACAATTGGATCAGCTCATTGTAATGCATTCAATGATCGG
TTTCGAGAGGACCCAAAGGGGAAACTGACATTGATAGACACGTCTCTGGACAGTTCTTATGCAAATGAACTAATGAGAAAGTGCCCAGCAAATGCAAGCTCATCTGTAACCGTTAACAAT
GATCCTGAAACATCATTTGTGTTCGATAATCAGTACTACCGCAACCTCTTAGCACACAAAGGGCTGTTTCAATCAGATTCTGTTCTTTTACACGATGAAAGAACAAGGAAGCAAGTGGAG
AATTTTGCAAATGATCAAGAAAGTTTCTTCAGTAACTGGGGTCTGTCATTTTTGAAGGTTACTAGCATTGGAGTGAAAACTGAAGATGAAGGGGAAATTCGACAAACTTGTTCAATGACT
AATGGGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGTTCAAATCCAGGAATTGGTTCATTTTGTAAAGCTAATGGCTACGTACTTTTTGTTTTTGTTCTGTTCCGTCTTGCTGCTTCTCCTTGCTGTGCCAGCCTCTCTTTCAACTTCTAT
GCAGCTTCATGCCCCTCTGCTGAGTTCATGGTTGCAAACACGGTGAGATCAGCTTCCTCTTTTGATCGCACCATCCCCGGGAAGCTCCTCCGCCTGCTCTTCCATGACTGCTTCGTTGAG
GGTTGTGATGCTTCTGTACTGCTACAAGGAAATGGGACAGAGCGAAGTGATCCAGCAAACGCATCTCTTGGAGGGTTTGAAGTTATTGATTCGGCGAAAAGAGTTCTTGAAATCTTCTGT
CCTGGGACTGTTTCTTGTGCTGATATTATTGCTTTGGCCGCTAGAGATTCTGTTGAAATA
GCTGGTGGCCCGGCAATTCAAATTCCTACAGGCAGGAGGGATGGGAGAGCATCAGCAGCT
GAAAACGTTAGAGCCAACATTGTAGATACAACATTCACAATGAATGAGATGATAAAGGCCTTTTCCTCTAAAGGCTTGTCCATGGATGACCTCGTTACTCTATCAG
GAGCTCACACAATT
GGATCAGCTCATTGTAATGCATTCAATGATCGGTTTCGAGAGGACCCAAAGGGGAAACTGACATTGATAGACACGTCTCTGGACAGTTCTTATGCAAATGAACTAATGAGAAAGTGCCCA
GCAAATGCAAGCTCATCTGTAACCGTTAACAATGATCCTGAAACATCATTTGTGTTCGATAATCAGTACTACCGCAACCTCTTAGCACACAAAGGGCTGTTTCAATCAGATTCTGTTCTT
TTACACGATGAAAGAACAAGGAAGCAAGTGGAGAATTTTGCAAATGATCAAGAAAGTTTCTTCAGTAACTGGGGTCTGTCATTTTTGAAGGTTACTAGCATTGGAGTGAAAACTGAAGAT
GAAGGGGAAATTCGACAAACTTGTTCAATGACTAATGGGTGA

Retrieve as FASTA