Entry information : CsPrx44 (orange1.1g020511m/Cs7g20700)
Entry ID 8910
Creation 2011-07-01 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2017-12-14 (Qiang Li)
Peroxidase information: CsPrx44 (orange1.1g020511m/Cs7g20700)
Name (synonym) CsPrx44 (orange1.1g020511m/Cs7g20700)
Class Class III peroxidase    [Orthogroup: Prx006]
Taxonomy Eukaryota Viridiplantae Streptophyta Rutaceae Citrus
Organism Citrus sinensis    [TaxId: 2711 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CsPrx44
start..stop
S start..stop
CclPrx41 665 0 1..325 1..325
VvPrx41 527 0 1..325 1..324
GhPrx06 524 0 7..325 12..328
VvPrx97 516 0 24..325 23..324
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1640..2029 390 N° 2 1291..1453 163 N° 3 624..1048 425  
complement(join(624..1048,1291..1453,1640..2029))


exon

Literature and cross-references CsPrx44 (orange1.1g020511m/Cs7g20700)
DNA ref. Citrus sinensis Annotation Project:   chr7 (17679641..17681335) Phytozome 12:   scaffold01115 (2029..624)
Protein sequence: CsPrx44 (orange1.1g020511m/Cs7g20700)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   326 (304)
PWM (Da):   %s   34985.83 (32695.7)  
PI (pH):   %s   8.49 (8.76) Peptide Signal:   %s   cut: 22 range:22-325
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MEGAFAVLVLFVAMAVTSVHCQAGTRVGFYSRSCPRAESIVKSTVQAHFRSDPTVAPGLLRMHFHDCFVHGCDASILINGPNTEKTAPPNRLLRGYDVIDDAKSQIEAACPGIVSCADILALAARDSVVVTRGISWQVPTGRRDGRISLASDTANLPGFTESVEAQKQKFLDKGLNTQDLVTLVGAHTIGTTACQIFKYRLYNFTTTTATGADPTIDATFIPQLRALCPENGDGARRVALDTGSPNRFDTSFFSNLRNGRGVLESDQKLWSDASTKAVVQRFLGVRGLLGLTFNVEFGRSMVKMSNIGVKTGTDGEIRKICSAIN*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGGGTGCTTTTGCAGTACTAGTACTTTTTGTTGCCATGGCTGTGACATCAGTTCATTGCCAAGCAGGGACTCGTGTTGGATTTTATTCAAGGTCATGTCCTCGAGCTGAGTCCATA
GTTAAGTCTACGGTTCAGGCTCATTTCAGGTCTGATCCCACAGTTGCTCCTGGGTTACTGAGGATGCATTTTCATGACTGTTTTGTCCACGGCTGTGATGCTTCCATTCTTATTAATGGC
CCCAACACTGAGAAAACTGCACCACCCAACCGTCTGTTGAGAGGATATGATGTAATTGATGATGCCAAATCCCAGATTGAGGCTGCATGTCCTGGCATCGTCTCTTGCGCTGACATTCTT
GCCCTCGCCGCCCGTGATTCTGTCGTCGTG
GTAACAATAATTCTCCACTCTCATCATCATTATTGTTAATAGTTGCCTTAAATACTATTGTTGGGCTTTACTTATCCGGTTAAAATTTTA
GGTCAAATAATTTTTGTAAACAATATCAGAGCCAAATTCTCAAGTTTGATTCACTTTACGTACAAACTAACATATTTTGTTGGACATGCATTGCAGACAAGAGGAATAAGTTGGCAAGTG
CCCACAGGACGCAGAGATGGCAGGATATCATTGGCATCCGATACTGCCAATCTTCCAGGTTTCACCGAGTCTGTTGAAGCGCAAAAGCAAAAGTTTCTTGACAAGGGTTTGAACACTCAG
GATCTTGTTACTCTTGTTG
GTAAGCACCAAATCAAATTAACTCATTTATATAGTGATTATCAAGTGCGGGCACCCATAACTTATAAAGCATGGATTTGAACCGATGGACATTTTTCTACG
ACCTCATAGTTCAAATCCGTACTTTATAAGATAGAAGAACTAATAAATAAAAAATTTCCTTTATGATCTGAGCTACTAAATTAAATTTATATGGATGATTGGTCTTTAAAAAATTTAACT
TTTACCTCTATTTGTTACCAGGAGCACATACAATCGGTACTACAGCTTGCCAAATATTTAAGTACAGACTTTATAACTTCACTACAACAACAGCAACAGGAGCTGATCCAACCATAGACG
CTACGTTCATTCCTCAACTCCGAGCACTCTGTCCGGAGAACGGTGACGGAGCAAGGCGCGTTGCACTTGACACCGGTAGCCCTAATAGATTCGACACGTCCTTCTTCTCGAATTTGAGAA
ACGGGCGGGGAGTGCTAGAGTCTGATCAGAAGCTATGGAGTGATGCTTCTACTAAAGCGGTCGTGCAAAGGTTCTTGGGTGTGAGAGGATTGCTAGGGCTGACCTTCAATGTGGAGTTTG
GAAGATCCATGGTTAAAATGAGTAACATTGGCGTCAAGACTGGCACTGATGGTGAAATTCGCAAAATATGTTCCGCAATTAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGGGTGCTTTTGCAGTACTAGTACTTTTTGTTGCCATGGCTGTGACATCAGTTCATTGCCAAGCAGGGACTCGTGTTGGATTTTATTCAAGGTCATGTCCTCGAGCTGAGTCCATA
GTTAAGTCTACGGTTCAGGCTCATTTCAGGTCTGATCCCACAGTTGCTCCTGGGTTACTGAGGATGCATTTTCATGACTGTTTTGTCCACGGCTGTGATGCTTCCATTCTTATTAATGGC
CCCAACACTGAGAAAACTGCACCACCCAACCGTCTGTTGAGAGGATATGATGTAATTGATGATGCCAAATCCCAGATTGAGGCTGCATGTCCTGGCATCGTCTCTTGCGCTGACATTCTT
GCCCTCGCCGCCCGTGATTCTGTCGTCGTG
ACAAGAGGAATAAGTTGGCAAGTGCCCACAGGACGCAGAGATGGCAGGATATCATTGGCATCCGATACTGCCAATCTTCCAGGTTTCACC
GAGTCTGTTGAAGCGCAAAAGCAAAAGTTTCTTGACAAGGGTTTGAACACTCAGGATCTTGTTACTCTTGTTG
GAGCACATACAATCGGTACTACAGCTTGCCAAATATTTAAGTACAGA
CTTTATAACTTCACTACAACAACAGCAACAGGAGCTGATCCAACCATAGACGCTACGTTCATTCCTCAACTCCGAGCACTCTGTCCGGAGAACGGTGACGGAGCAAGGCGCGTTGCACTT
GACACCGGTAGCCCTAATAGATTCGACACGTCCTTCTTCTCGAATTTGAGAAACGGGCGGGGAGTGCTAGAGTCTGATCAGAAGCTATGGAGTGATGCTTCTACTAAAGCGGTCGTGCAA
AGGTTCTTGGGTGTGAGAGGATTGCTAGGGCTGACCTTCAATGTGGAGTTTGGAAGATCCATGGTTAAAATGAGTAACATTGGCGTCAAGACTGGCACTGATGGTGAAATTCGCAAAATA
TGTTCCGCAATTAACTAA

Retrieve as FASTA