Entry information : CsPrx46 (orange1.1g020619m/Cs9g05130)
Entry ID 8911
Creation 2011-07-01 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2017-12-14 (Qiang Li)
Peroxidase information: CsPrx46 (orange1.1g020619m/Cs9g05130)
Name (synonym) CsPrx46 (orange1.1g020619m/Cs9g05130)
Class Class III peroxidase    [Orthogroup: Prx014]
Taxonomy Eukaryota Viridiplantae Streptophyta Rutaceae Citrus
Organism Citrus sinensis    [TaxId: 2711 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CsPrx46
start..stop
S start..stop
CclPrx83 656 0 1..323 1..323
MePrx88 517 0 7..323 2..319
CclPrx46 514 0 1..323 1..322
CsPrx47 509 0 1..323 1..323
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1860160..1860369 210 N° 2 1859645..1859836 192 N° 3 1859354..1859519 166 N° 4 1858265..1858668 404
complement(join(1858265..1858668,1859354..1859519,1859645..1859836,1860160..1860 369))


exon

Literature and cross-references CsPrx46 (orange1.1g020619m/Cs9g05130)
DNA ref. Citrus sinensis Annotation Project:   chr9 (2995165..2997538) Phytozome 12:   scaffold00011 (1860369..1858265)
Protein sequence: CsPrx46 (orange1.1g020619m/Cs9g05130)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   324 (297)
PWM (Da):   %s   35190.72 (32515.3)  
PI (pH):   %s   6.65 (6.05) Peptide Signal:   %s   cut: 27 range:27-323
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKGSLSFFLISLVALLLGACRGGGLGKNFYKETCPEAEDIVQKIIWKNVALNSTLPAKFLRMHFHDCFVRGCDASVLIDSTASNSAEKDSIPNQTVGGFDVIEEVKTELEKKCPGIVSCADIVALATRDSVSFQFEKPLWEVLTGRRDGRISLVSEANSQIPAPSFNFSRLKQSFASKGLTVHDLVVLSGGHTIGVGHCNFFSRRLYNFTGKGDADPSLDSTYAAFLRTKCRSLADNTTIVEMDPGSGMDFDNNYYKILRQNKGMFQSDAALLTDNGASNIVDELLDPAKFFTEFAQSMERLGAVGVLTGTSGEIRKKCNVVN*

Retrieve as FASTA  
Remarks Complete sequence from grnomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGGGTAGCTTAAGTTTCTTCTTGATCTCTTTGGTGGCACTACTTTTAGGAGCTTGCAGGGGAGGGGGATTGGGGAAAAATTTTTATAAGGAAACTTGCCCCGAGGCTGAAGATATT
GTGCAAAAAATCATTTGGAAAAATGTTGCACTCAATTCAACTTTGCCAGCAAAATTCCTTAGAATGCATTTTCACGATTGTTTTGTTAGG
GTAACACATGTTTATATTCGTTTATAATTC
ATAGTTATTTTTTCATGATATAATTTATATTTTTTAACATGCGGACATGTTTGTCTGAGAACTTTTTTTTTCATCCCAAATATATTTTTTTACACAATATATAGTTAGTCTCTCTGCATA
TATTATATATATGCATATCTGCATTTGTATACATTTACTTTAATTTAAACAAAAACTTAGATAAGCTGAGAATTCACGTTGCTTTTAAAAATGGTGGAAAAAAAAATTCATGCATGATGC
GTTATTACTATTTGATAAATTAATGGGCTAGTTATTTCATCGATTTGTCTTAGGGTTGCGATGCCTCAGTACTGATAGACTCAACAGCAAGCAACTCAGCTGAAAAGGATTCAATCCCGA
ACCAAACCGTTGGGGGATTTGATGTTATAGAAGAAGTCAAAACTGAGCTTGAGAAGAAATGCCCTGGAATTGTTTCTTGTGCCGATATTGTAGCTCTAGCTACTAGAGACTCCGTTTCCT
TCCAA
GTAAGTTCTAAATTAAATTAAGTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCACTTTCTTATGATGTTACATATTGTGGTTATATTG
TATGGTGCAGTTCGAGAAGCCATTGTGGGAAGTGCTTACAGGAAGAAGGGATGGTAGAATTTCACTTGTTTCGGAAGCGAATTCGCAGATTCCTGCACCATCCTTCAACTTTAGTCGGCT
CAAACAATCTTTTGCCAGCAAAGGCCTTACTGTTCATGACCTGGTCGTTTTATCAG
GTATTTAGAAATAAAATTAGAACGAGTTAGTTAAAGTACATGCATGCATGGCTCGTTAATTGAA
AGTTAATGTGTCAAAATTTTGTTATGAAGCAATGATTTATAAGGTATAAACATTATATATCATACGCATCCCAGCCATTCCTGCAGTTTTTAAACTTAGAATTTGACTTGCGTGGGTTTG
TGTAGGAAGAATAATTTTCTCTGTAACTTGTAAGTAACATTTCCTGAACTGATCATCAAGTTACGTAATAACCAAACTTTACCTGAAAGAAATTTGGGACCCCTCATTGTTTAAATTGTC
TCAAATTAGGATATAGGCTCCCGAAACTTACCCAAATGACGAAACTACAAGTACTAACTTCAATTTTGACATTCAGAATAAAGGAGAGATAAAAAGGGATCTATTTCTTACAAATGGGTA
AATCACGTCCTCATTTGAGATATATGTACGTAGTACACAGTATAAGGACTCCAAAATTATTACTATAAGGAGACTTTAGGCCACAGTTTGGGCATTCTCAGCCCAAACCATATCTTGAAT
AATAATAAAAGAAATTCTGTGAGTACTCCTTGTGTTCCTCAATGCACCCTCTACAGTGGGTGTAATTAAATTTAAGATATTATTAGTAGACAGATTTTTTCATATTAATTTGAGTCAATT
GGTCGTGACGTGAGTGAGCAGGTGGACATACCATTGGAGTTGGTCACTGCAATTTCTTCAGCAGGAGGCTGTACAATTTCACAGGAAAAGGTGATGCAGATCCATCATTGGATTCAACTT
ATGCTGCATTCTTGAGAACCAAATGCAGAAGCTTAGCAGATAACACAACCATAGTGGAAATGGACCCCGGCAGCGGCATGGATTTTGATAACAATTACTACAAAATCCTGAGGCAGAATA
AAGGAATGTTCCAATCTGATGCTGCACTTTTGACTGACAATGGCGCTAGCAACATTGTCGATGAGTTGCTGGATCCGGCCAAATTTTTCACTGAGTTTGCTCAGTCCATGGAGAGATTGG
GAGCCGTTGGAGTTCTAACGGGAACTTCAGGAGAGATCAGAAAGAAGTGCAATGTGGTCAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGGGTAGCTTAAGTTTCTTCTTGATCTCTTTGGTGGCACTACTTTTAGGAGCTTGCAGGGGAGGGGGATTGGGGAAAAATTTTTATAAGGAAACTTGCCCCGAGGCTGAAGATATT
GTGCAAAAAATCATTTGGAAAAATGTTGCACTCAATTCAACTTTGCCAGCAAAATTCCTTAGAATGCATTTTCACGATTGTTTTGTTAGG
GGTTGCGATGCCTCAGTACTGATAGACTCA
ACAGCAAGCAACTCAGCTGAAAAGGATTCAATCCCGAACCAAACCGTTGGGGGATTTGATGTTATAGAAGAAGTCAAAACTGAGCTTGAGAAGAAATGCCCTGGAATTGTTTCTTGTGCC
GATATTGTAGCTCTAGCTACTAGAGACTCCGTTTCCTTCCAA
TTCGAGAAGCCATTGTGGGAAGTGCTTACAGGAAGAAGGGATGGTAGAATTTCACTTGTTTCGGAAGCGAATTCGCAG
ATTCCTGCACCATCCTTCAACTTTAGTCGGCTCAAACAATCTTTTGCCAGCAAAGGCCTTACTGTTCATGACCTGGTCGTTTTATCAG
GTGGACATACCATTGGAGTTGGTCACTGCAAT
TTCTTCAGCAGGAGGCTGTACAATTTCACAGGAAAAGGTGATGCAGATCCATCATTGGATTCAACTTATGCTGCATTCTTGAGAACCAAATGCAGAAGCTTAGCAGATAACACAACCATA
GTGGAAATGGACCCCGGCAGCGGCATGGATTTTGATAACAATTACTACAAAATCCTGAGGCAGAATAAAGGAATGTTCCAATCTGATGCTGCACTTTTGACTGACAATGGCGCTAGCAAC
ATTGTCGATGAGTTGCTGGATCCGGCCAAATTTTTCACTGAGTTTGCTCAGTCCATGGAGAGATTGGGAGCCGTTGGAGTTCTAACGGGAACTTCAGGAGAGATCAGAAAGAAGTGCAAT
GTGGTCAATTAA

Retrieve as FASTA