Entry information : CsPrx48 (orange1.1g020883m/Cs9g16590)
Entry ID 8914
Creation 2011-07-01 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2017-12-14 (Qiang Li)
Peroxidase information: CsPrx48 (orange1.1g020883m/Cs9g16590)
Name (synonym) CsPrx48 (orange1.1g020883m/Cs9g16590)
Class Class III peroxidase    [Orthogroup: Prx036]
Taxonomy Eukaryota Viridiplantae Streptophyta Rutaceae Citrus
Organism Citrus sinensis    [TaxId: 2711 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CsPrx48
start..stop
S start..stop
CclPrx115 659 0 1..320 1..320
PpePrx62 531 0 6..320 10..324
MePrx90 530 0 9..320 12..323
RcPrx67 527 0 4..320 7..323
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 533991..534200 210 N° 2 534324..534512 189 N° 3 534798..535361 564  
join(533991..534200,534324..534512,534798..535361)


exon

Literature and cross-references CsPrx48 (orange1.1g020883m/Cs9g16590)
DNA ref. Citrus sinensis Annotation Project:   chr9 (16075315..16076685) Phytozome 12:   scaffold00062 (533991..535361)
Protein sequence: CsPrx48 (orange1.1g020883m/Cs9g16590)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   321 (297)
PWM (Da):   %s   35087.81 (32610.4)  
PI (pH):   %s   7.69 (7.74) Peptide Signal:   %s   cut: 24 range:24-320
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVAKNLVCAIILLLLVSLGQAEAALNAHYYDQTCPQAEKIILDAVRNASMHDPKVPARILRMFFHDCFIRGCDASVLLDSTPQNKAEKDGPPNISVRSFYVIDDAKAELEKACPHTVSCADIIAIASRDVVTMSGGPYWNVLKGRKDGRVSKASETRSLPAPTFNVTQLIQSFAQRGLGVQDLVALSGGHTLGFSHCSSFEARLRNFSSLLDIDPSMDLDFAEKLRSKCPKPNKDRNAGQFLDSTSSAFDNNYYKQLTVGKGVFGSDQSLFGDFRTKWIVESFAIDQGLFFKEFVNSMVKLGNVGIIENGEVRLKCGVVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTTGCAAAGAATCTCGTCTGTGCAATTATTCTGCTTCTCTTAGTGTCACTTGGGCAGGCAGAGGCAGCACTGAATGCACATTATTATGATCAAACGTGCCCGCAAGCCGAGAAAATC
ATTTTAGATGCTGTTCGTAATGCTTCAATGCATGACCCGAAAGTCCCAGCTCGCATCCTCAGGATGTTCTTTCACGATTGTTTCATAAGG
GTATGATTGTTAATTAATTCTTCTCCTCTT
TAAGTACTCTGAAAAATTAACGAGCCAAAAATTAATTGAATGGCCTCTAATTTGCTATGGTTTCAAATGATGATATTATGGTATGAAACATAGGGATGTGATGCGTCGGTGTTGCTGGAC
TCGACTCCGCAAAACAAAGCTGAAAAGGATGGCCCTCCGAATATCTCAGTTCGATCATTTTATGTGATTGATGACGCAAAAGCTGAGCTTGAAAAGGCTTGCCCACACACAGTTTCTTGC
GCCGATATAATCGCCATTGCATCAAGGGATGTAGTAACCATG
GTGATGCTCAATTTCTTAGCGTGCTGTATAATATATACATCACGTGCAAATTGCACTCAATATGCCCCAATAACATAG
AAATTGCATAAGCTAGAATTCTGAGTGTTTTCTCATACACCTGACCTTACAAATTATGTAATCTTATTACTCAATCCACTTACCCGACCTTACTCGACACCGAGTTTNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNTGTCTTTCTTGAATTATTATATATGATATATTATCTTGATTTATATCTTTTTATTTGTTTATTTTTGATAGTCTGGAGGACCTTATTGGAATGTTCTAAAAGGA
AGGAAAGATGGAAGAGTGTCCAAAGCATCCGAAACAAGAAGCTTACCAGCACCAACGTTCAACGTGACACAACTCATTCAAAGTTTTGCACAAAGAGGTTTAGGAGTTCAAGATTTGGTT
GCTTTATCAGGTGGCCACACTCTAGGGTTTTCACACTGCTCATCATTTGAAGCCAGGCTACGTAACTTCAGTTCACTGCTTGACATTGACCCATCTATGGATCTTGACTTCGCCGAAAAG
CTTAGAAGCAAATGCCCAAAACCAAACAAAGATCGCAATGCTGGACAGTTCTTGGACTCTACATCGTCCGCTTTTGATAACAACTATTACAAACAACTTACGGTAGGTAAGGGCGTGTTT
GGATCAGATCAATCTCTGTTTGGCGATTTCAGGACCAAGTGGATTGTTGAATCGTTTGCCATAGACCAGGGTTTGTTCTTCAAAGAGTTCGTGAATTCTATGGTGAAGCTTGGAAATGTG
GGTATTATTGAAAATGGAGAAGTGAGACTCAAATGCGGAGTGGTTAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTTGCAAAGAATCTCGTCTGTGCAATTATTCTGCTTCTCTTAGTGTCACTTGGGCAGGCAGAGGCAGCACTGAATGCACATTATTATGATCAAACGTGCCCGCAAGCCGAGAAAATC
ATTTTAGATGCTGTTCGTAATGCTTCAATGCATGACCCGAAAGTCCCAGCTCGCATCCTCAGGATGTTCTTTCACGATTGTTTCATAAGG
GGATGTGATGCGTCGGTGTTGCTGGACTCG
ACTCCGCAAAACAAAGCTGAAAAGGATGGCCCTCCGAATATCTCAGTTCGATCATTTTATGTGATTGATGACGCAAAAGCTGAGCTTGAAAAGGCTTGCCCACACACAGTTTCTTGCGCC
GATATAATCGCCATTGCATCAAGGGATGTAGTAACCATG
TCTGGAGGACCTTATTGGAATGTTCTAAAAGGAAGGAAAGATGGAAGAGTGTCCAAAGCATCCGAAACAAGAAGCTTACCA
GCACCAACGTTCAACGTGACACAACTCATTCAAAGTTTTGCACAAAGAGGTTTAGGAGTTCAAGATTTGGTTGCTTTATCAGGTGGCCACACTCTAGGGTTTTCACACTGCTCATCATTT
GAAGCCAGGCTACGTAACTTCAGTTCACTGCTTGACATTGACCCATCTATGGATCTTGACTTCGCCGAAAAGCTTAGAAGCAAATGCCCAAAACCAAACAAAGATCGCAATGCTGGACAG
TTCTTGGACTCTACATCGTCCGCTTTTGATAACAACTATTACAAACAACTTACGGTAGGTAAGGGCGTGTTTGGATCAGATCAATCTCTGTTTGGCGATTTCAGGACCAAGTGGATTGTT
GAATCGTTTGCCATAGACCAGGGTTTGTTCTTCAAAGAGTTCGTGAATTCTATGGTGAAGCTTGGAAATGTGGGTATTATTGAAAATGGAGAAGTGAGACTCAAATGCGGAGTGGTTAAT
TAA

Retrieve as FASTA