Entry information : CsPrx23 (orange1.1g024722m/Cs3g02270)
Entry ID 8921
Creation 2011-07-01 (Qiang Li)
Last sequence changes 2011-12-05 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2017-12-14 (Qiang Li)
Peroxidase information: CsPrx23 (orange1.1g024722m/Cs3g02270)
Name (synonym) CsPrx23 (orange1.1g024722m/Cs3g02270)
Class Class III peroxidase    [Orthogroup: Prx012]
Taxonomy Eukaryota Viridiplantae Streptophyta Rutaceae Citrus
Organism Citrus sinensis    [TaxId: 2711 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CsPrx23
start..stop
S start..stop
CclPrx103 632 0 1..323 1..323
CclPrx97 629 0 1..323 1..323
CclPrx117 627 0 1..323 1..323
CclPrx85 596 0 1..323 1..317
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 515313..515732 420 N° 2 514991..515153 163 N° 3 514466..514854 389  
complement(join(514466..514854,514991..515153,515313..515732))


exon

Literature and cross-references CsPrx23 (orange1.1g024722m/Cs3g02270)
DNA ref. Citrus sinensis Annotation Project:   chr3 (1890313..1891352) Phytozome 11:   scaffold00085 (515732..514466)
Protein sequence: CsPrx23 (orange1.1g024722m/Cs3g02270)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   323 (294)
PWM (Da):   %s   34712.43 (31533.9)  
PI (pH):   %s   8.26 (8.39) Peptide Signal:   %s   cut: 30 range:30-323
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASFSQTNKFTCTIFVSTLLLIISTQCEAQLSPTFYDATCPSALNTIRTGIRNAASRERRMAASLIRLHFHDCFVQGCDASILLDDSSSIDSEKNALPNFKSARGFEVIDSVKSQLERVCPGVVSCADIVAVAARDASFAVGGPSWTVKLGRKDSTTASRSLAENLPSFTDGLDKLISTFATKGLNARDLVALSGAHTIGQAQCAFFRDRIYNNQSNIDAGFASTRRRQCPANGGDSNLSPLDLVTPNSFDNNYFKNLIQKKGLLASDQVLFSGGSTDYIVDEYSKNPSKFKSDFAAAMIKMADISPLTGTAGQIRRVCNIVN

Retrieve as FASTA  
Remarks Complete sequence from genomic. Incorrect prediction from phytozome (5' end is missing).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCCTTTTCTCAAACAAATAAGTTTACGTGTACAATTTTTGTCTCCACGTTGTTGTTGATCATCTCTACGCAATGTGAAGCACAACTTTCACCAACATTCTACGATGCCACTTGC
CCAAGTGCCCTCAACACAATCCGAACAGGCATTAGAAATGCTGCTTCACGAGAGCGTAGGATGGCGGCATCCCTCATTCGCCTCCATTTTCATGATTGCTTCGTTCAAGGTTGTGACGCG
TCCATTTTGTTGGACGATTCCTCCTCCATTGACAGCGAGAAAAATGCACTTCCAAATTTTAAATCAGCTAGAGGGTTCGAAGTTATAGATAGTGTCAAGTCTCAACTGGAGAGAGTTTGC
CCTGGAGTTGTTTCATGCGCTGATATCGTTGCTGTTGCAGCCCGTGATGCTTCTTTCGCT
GTGAGTAAATCATCATTAATTTTCTACAAGATTAATACAATAAGAGACATAGTGCTAACA
GAAACAGTGATAAGCCGATGCCGTTCTGTGCTATTAATTTTGATATATAATTCATTGTTAGTTCTGGTTAATTAATTAATTTGAAAAAATTAATTACAGGTTGGAGGACCATCATGGACA
GTTAAGCTTGGTAGAAAAGACTCAACAACTGCAAGCAGAAGCCTGGCTGAAAATCTCCCTAGCTTTACAGATGGCCTGGACAAACTTATTTCCACCTTCGCTACCAAAGGCTTGAATGCA
AGAGACTTGGTTGCCCTTTCAG
GTATCCCTCCCTCTCTCTCTCTATATATATATAATATTTGCCATATCATAATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNGTTTCATTTGAAATTCAGGAGCTCATACAATTGGCCAAGCACAATGTGCATTTTTCCGTGACAGGATTTATAACAATCAAAGCAATATTGATGCTGGATT
CGCGAGCACTCGAAGGCGTCAGTGCCCGGCTAATGGTGGCGACAGCAATCTATCACCACTTGATTTGGTGACACCCAATTCTTTCGATAACAATTACTTCAAGAATCTCATTCAGAAGAA
GGGACTTCTCGCATCAGACCAAGTTCTTTTTAGTGGTGGATCCACCGACTACATCGTTGATGAATATAGCAAAAACCCTTCAAAATTTAAATCTGATTTTGCAGCTGCCATGATTAAGAT
GGCAGATATCAGTCCTCTCACAGGCACTGCTGGACAAATTCGAAGAGTTTGCAATATTGTCAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCCTTTTCTCAAACAAATAAGTTTACGTGTACAATTTTTGTCTCCACGTTGTTGTTGATCATCTCTACGCAATGTGAAGCACAACTTTCACCAACATTCTACGATGCCACTTGC
CCAAGTGCCCTCAACACAATCCGAACAGGCATTAGAAATGCTGCTTCACGAGAGCGTAGGATGGCGGCATCCCTCATTCGCCTCCATTTTCATGATTGCTTCGTTCAAGGTTGTGACGCG
TCCATTTTGTTGGACGATTCCTCCTCCATTGACAGCGAGAAAAATGCACTTCCAAATTTTAAATCAGCTAGAGGGTTCGAAGTTATAGATAGTGTCAAGTCTCAACTGGAGAGAGTTTGC
CCTGGAGTTGTTTCATGCGCTGATATCGTTGCTGTTGCAGCCCGTGATGCTTCTTTCGCT
GTTGGAGGACCATCATGGACAGTTAAGCTTGGTAGAAAAGACTCAACAACTGCAAGCAGA
AGCCTGGCTGAAAATCTCCCTAGCTTTACAGATGGCCTGGACAAACTTATTTCCACCTTCGCTACCAAAGGCTTGAATGCAAGAGACTTGGTTGCCCTTTCAG
GAGCTCATACAATTGGC
CAAGCACAATGTGCATTTTTCCGTGACAGGATTTATAACAATCAAAGCAATATTGATGCTGGATTCGCGAGCACTCGAAGGCGTCAGTGCCCGGCTAATGGTGGCGACAGCAATCTATCA
CCACTTGATTTGGTGACACCCAATTCTTTCGATAACAATTACTTCAAGAATCTCATTCAGAAGAAGGGACTTCTCGCATCAGACCAAGTTCTTTTTAGTGGTGGATCCACCGACTACATC
GTTGATGAATATAGCAAAAACCCTTCAAAATTTAAATCTGATTTTGCAGCTGCCATGATTAAGATGGCAGATATCAGTCCTCTCACAGGCACTGCTGGACAAATTCGAAGAGTTTGCAAT
ATTGTCAACTAA

Retrieve as FASTA