Entry information : GmAPx13 (Glyma02g37160.1)
Entry ID 8940
Creation 2011-07-04 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-11-23 (Christophe Dunand)
Peroxidase information: GmAPx13 (Glyma02g37160.1)
Name (synonym) GmAPx13 (Glyma02g37160.1)
Class Ascorbate peroxidase    [Orthogroup: APx004]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmAPx13
start..stop
S start..stop
GmAPx14 632 0 1..347 1..340
MtAPx04 551 0 1..347 1..353
VvAPx07 538 0 1..347 1..344
MeAPx02 534 0 1..347 1..349
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 42497520..42497609 90 N° 2 42497052..42497156 105 N° 3 42494659..42494743 85 N° 4 42494526..42494560 35
N° 5 42494361..42494426 66 N° 6 42494229..42494269 41 N° 7 42493477..42493607 131 N° 8 42493190..42493296 107
N° 9 42492916..42493053 138 N° 10 42491996..42492130 135 N° 11 42491769..42491879 111  
complement(join(42491769..42491879,42491996..42492130,42492916..42493053,4249319 0..42493296,42493477..42493607,42494229..42494269,42494361..42494426,42494526..4 2494560,42494659..42494743,42497052..42497156,42497520..42497609))


exon

Literature and cross-references GmAPx13 (Glyma02g37160.1)
DNA ref. Phytozome 12:   Gm02 (42497609..42491769)
Protein sequence: GmAPx13 (Glyma02g37160.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   348
PWM (Da):   %s   37727.32  
PI (pH):   %s   6.54
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGVSFLSTCPSLLPLVAYDTPPSARYQPRSVSICCNKTISDVSDGEPFHWRRRDVLKCAGATVGLELIGSSGSLVEMANAADLIQRRQRSEFQSKIKETLFTAIKGNPDLIPSLLTLALNDALTYDKATKSGGPNGSIRFSSEIGRPENTGLSAALNLLEEAKKEIDSDSKGGSISYADLIHIAAQSAAKATFLAAAIRKCGGKEEKGKTLYNAYGSNGQWGLFDRQFGRADAQDPDPEGRVPLWEKASVQEMKDKFVAVGFGPRQLAVLSAFLGPDQNATETLLASDPDVAPWVQKYQRSRETVSQTDYEVDLITTFTKLSTLGQQINYEAYTYPPPKIDITKLKL*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTGTCTCCTTCCTCTCAACTTGCCCTTCTCTGCTTCCACTCGTTGCTTATGATACACCACCCTCCGCCAGATACCAACCTCGTTCAGTAAGTTTCCACTTTGCTTTACTTGTGTCT
CTTAACACACGTACAATGCAGTTGCAAATCATGCAAGTTCATGGATGCTGTTATGTCGCATTGTGAATGAATTATGGGAAATGGCTATGGAATTTTGCATTGATATGACAAAGAAATACT
CCATTTTTTTATCGCCAAATGTTAGTTTGCTAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNAATACTCGATCATTATAACTTATAGAGTGTTTCTTACTTGTCGTTAAGTCAGTTATAAGTTATAACCTTTGTTTATTCAATGTGTTCTTAGGTGTCCATTTGTTGTAATAAAACCATA
AGCGATGTTAGTGATGGAGAGCCGTTCCATTGGAGAAGGAGAGATGTTCTCAAATGCGCCGGGGCAACCGTTGGCCTG
GTAAGAGCCATTCTGCTACAATTTTATAATAAAGTTTTTCTC
TTTTTATTTGTTTTTACCCTTTCCATCTGATGAATATGCTTTACTAATATAAACAGAATCATTATTTGTACAACTATTAAGTTCATGTTCTTATGATTTCATGTTTTTTACATGAATTCA
CTAGTAGGAAATTTGTTCTCACTTAACATTGGTGGGATTGTTATGCTTGCAAATGTTAATTCTGGTCTTGAAACAATGTTATCTTTATTTTGTTCTCTGTTTCTTTTCCTTTCCATATTT
GAAGCTCTGTCAAATTTTCTTTGCTTGGTGATGATGAACCTTAAGAGTTACTGCAACAATATTACCAAAAAGGCTAAAATGACCCAGGGATATCTATTTCATTTGCCCCAACACCTATGA
TTTTAATGGATTAATTATATATGCAAAAAACTAGCTGTAAGTGTAATACTGGTTACTATAATATAGCTTTAGCTTATGTAGAGAATGAGTCACTTAATAACAAAGTAATTAACATGATTC
AGATGTCAGTTAGGTAGCTCATATACCTACAAGATGTTTAACACAGCAAGACACCACTGATAAAAGACAGATGGCTGACAAGTAGCTTCTTATCTGCGCAATATGAGATATCAGATGTCA
GAAAACAAAAATGAAAATTTCAACTAACAACAAACAAGAGCAACCAATCAAACAAAAAATGAGAGGGAAATGGAAGAAAGTTCTTGCACAAGGATTTTTATGCAGGTTTGATCTCTAACA
TGGAGGCTACATCTAGTCCCCACCCAATGTGAGGTTTTTCCACTATCTAATAACTTAGTAGTCTTTGAATCATCTAGCCTTAACAATTAGTTGCACCATAACTCTTCACAGTTAGCCCCG
CGGTCACTCTCGAACCAATATCCCTAGCTCTGACTGATATGGAATAGAATGGAAAACAAATCCAAGAGTGCTCTCCTGCTAAACCTAGAGTACTCCTCTAGGGCTGAGTGCTTCTTGAAC
CCAATTTCAGATACACTCTACATATGGAAACATCAAATATCATTCAATAACCAAAGCTGGTTGAGGTTTATGATACATAGACCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNAGACGAGACAAAATTCTTAAATCTAAACTTAACCAAAATCCCTAAATAATAGTTAACTAGATAATAACTCAATCTATATCATACATGCTTGATTAAACACCCACAC
TCAACTTTACAAGAGATTAAGAAAGATTGAACACTCTCTTTTAGTGTAAATGCATTCAACTAACTAACTGAATGAGTACAAGAAGATTGACTCTTCAAGGAAGCTTTATTGTGGAAAAAA
ATAAAATTGTCTAGTTAGTTTTTATCCTGTCCAAGGAGCTGACCATTTATAGAAAATGCAGTCATTCCAGCATTCATTTTATCACTGCACAAGGACAAAATTCAAATGAAAAGCCTGTCC
TTTAATGACTAATGAGATATTTTCCAAAAGATAGCTTATTGATCTGGGTGCCTCACTTTTTATTACAATATTTGAACATTACAAGATCTTTTGGAAGTGTTTGAGACATTCCACTAGGCT
CTAGACTCATTTGGATTAAGATAGTGCATAACCTTTTCAAGTGTCTCATCTAAGTGGTTTTAGACAAAAAAATTGCAGCAACTCATATCAGCACAAAGTCATTGACTCTTAAGTAGATTT
ACTTCTTAGGCATTTTTCTTTGCAATTTTGTTATGTAATATAATCTTCTACAGATAGGTCCAGCGGTTGTCTTTGAAAAGATCCGTTTCATTTATTATAAAACAAATCTGATATACCTTC
AATTCTCTTTAAGGATTTGTACGTCAAGAATCTCAAGATTGCACTAGCTCATCCTTGAACAAACGAACACCTCTTCTTCCCATCGCTTCCAGCATTTCATCTTCTGTTATTTAGAGATAA
TTTTGCAAAACCTTGCACGACTAAGTCTCAGGACAAAGTCCAAGTGAAATTAGCAAATGCCATCAAGTTTTATGTGTGTGTGTTTTTTTCTTTTGTTCTAAGTTGTATGTTATCATCACA
AAGTAGTTCAAGTAGGAAGGCTAACATGTTGCACCATTAGTTTTGCCTCGTGATTAATCCAAATTTTTACAGTCAACATGGAATCCAGTGGCTCTTCATATTTGTTGCCTCCTTTTGTTT
CTGTTTTCGTATAGCATCATTGTTCTTTTGAGTATCTAATGCAATAAGTACTTAGTGAATAAGATTGATGTGATGATGAGTTTTGGTCAGTTGTATCTGTTTTCAGGAATTAATTGGAAG
CTCCGGATCTCTTGTTGAAATGGCTAATGCTGCTGACCTGATACAGCGCAGACAGCGTTCTGAATTTCAAT
GTAAGATCCTTTAGGTCTACATGTTCATGTGACTATTAGTCATGTCAAA
TTCAACTAATCTCTCGTCTTAGCTGAGTTAGTTCTTTCTATTCTTACAGCTAAGATTAAGGAAACACTTTTTACAGCCATAAAGGTATAATATTTGACTTGCATTTAACTGTAAAAATTG
ACTATACAATTATCCAACTCCTATTATGGATATAATCTAATTTGACATAGGACTTCTTTTCAGGGAAATCCTGATCTTATTCCATCCTTACTGACACTGGCTCTAAATGATGCTTTGACT
TATGATAAG
GTGAGAAAAACACACAAGTGTGTGCATCTGCGGCATAGTTGTTTTCCATCATTTAAAATGAGTACTGATTGGCAGATGCTTAAGTTTGTAGGCAACAAAATCAGGTGGTCC
AAATGGCTCTATACGGTTCAG
GTACTTCTTTTCGGTTTTGATATTCATGAGATTGTACTCTATAACTAATAGAACCTAAGGGGGCATTTGATTTGAGAAAATATTTTGTTTTCATTTTCT
ATTTTTACTTTGTTTCCTATTTTCTGAAGTTTATATGGGAAAAAGTGAAAACAGGAAATGAAAACTAAAAACAATAAAAGAAAAAGTTGTTTTCATTGTTCTCTATACAAACTTCTGAAA
AAAGGAAATAAATTGAAAACAAAAAATGTTTTCTCAAACGAAACAACCCCTTGATAATTTACATTCTATGATGTTAACAAATAACCGTAGGTGGATTTTTTTATTCTCTTTATAGAACAG
TTTGTCTACTAAATAAGCTACACTGAGATGGTTGTTATTGCTGCATCCATTTCTCTTACTTTTCTAGGTTTTCTCTCTCTCTCTTCTTAGAAGGTGGTTTTTTTTTTTTTTACTTTGGAA
GCTGTGCTTCTTAGTTATTAGTAGTGTATCTTAAATTTCTAGTTTCACTAGCAATTTCTGGTCTCCTTCACTTGTGTGCATCAGAAATTTATACTTCATTACTTACTAATAAGTAATAAT
CATAATTTTTTCTCCTTTTTATTTTTCTAATTCTGCCTGAAGCTCAGAAATAGGTAGACCAGAAAATACAGGGCTTTCAGCAGCCTTGAATTTATTAGAGGAAGCCAAAAAGGAAATAGA
CTCAGATTCCAAAGGTGGATCCATTTCCTATGCAGATCTGATTCACATTGCAG
GTTATACTTTTTATCATCACCTAGTTAATGCTTTATAGTTATTAATAATACTTGTTTCACTTGTATA
TTCTATGTCAGTTAAATATAACCATTTATTTGAAAATTATTTGTGACTATGGTGGGTAGAAGTTGTGGAGGTATGTTCTAATTCCCCCGACTTCATTGACTTAATTTTTGTAGCACAAAG
TGCTGCCAAGGCTACATTTTTAGCTGCTGCCATTCGCAAATGCGGTGGAAAAGAGGAGAAAGGGAAAACACTGTACAATGCATACGGATCAAATGGACAG
GTTTGCATATTCTTCACTTA
TAATCTGCTTAATAACATCTCTATGGTGACAATCCTCAAATGTAGGTTTGTTCGATAATATGCTTAATACTATCTTTACTTATTTGCAAATTCATGCAATTTTTATTGTGAAACAGTGGG
GTTTGTTCGATAGACAATTTGGTAGGGCTGATGCTCAAGACCCAGATCCAGAGGGAAGAGTTCCACTATGGGAGAAGGCAAGTGTACAGGAAATGAAAGACAAGTTTGTTGCTGTAGGCT
TTGGTCCTCGCCAG
GTACTTAACATATTTCATCGCTGTTTTTGCTAACTGAAATGTAGCAAGTCATACATACAATCAAAGATGTATGTACACAGCTCAGAGTAGAAATTGTGATCATGGT
TTATATGCTGCAAGTGCAAAGTTCAACTTAGCCTGGCATCAGTTTTTTTCCCTCTTCAGTGTGGCTTTAAAAAGATGAAAGGAGTTTCATATCTAAAACTAAATAAATAAGGTGAAATGA
CAAAAGCAAGTCTTAACATTTTCACTCTAGCGAGTTCTCTATTAAACAAATTATTTGTCCAGATCATACAAGTCTGTCGAACTATAATGCTATATGATGAATTGATGATTATGCTTTAAA
AAGCAGAATCTTTTTGCCTTTGCATATTTTAACTCAAACCGTGTGGAAGTGAGAAGATACCCCTTGACCTTTGTTCCATGACTCATTGGTTTTACCGGTCAATGGCCATACAAATGTTCA
TATATACTAACAAATTTGTCCTTAAGCCATTCTTGTCACCTTATTCTTGGACTAGCTGTTATCCTTGCAAGTTACATCTTCTCGCTCAAGCTGTTCCTTCCCACCTTTTATTGAACACTT
CATAGATCCATTGTTTTTTTACTTTTCTTATTGTATCTTTTTAATACTCACTGTTGCAGACTTTTGGAATGTCAAAAAGGAGATTAGAGGGTAAAATAAATTGGAAAAAAAGCACACATC
CTTTAATGTTCCACATACCATAAAAGGGAAGTTGATAACTTGATATTACTAATTCATTTCCTTTTGTGTTTTTGGTCAGCTGGCTGTTTTATCTGCATTCTTAGGTCCTGATCAAAATGC
AACAGAAACCTTATTGGCCAGTGATCCTGATGTTGCTCCATGGGTTCAGAAATACCAACGGAGCCGTGAAACTGTCTCTCAGACAGATTATGAG
GTAAGTTTATCTATGAATAGCTCCAT
CCATGGACAGCAATGAAGTTCCTTAAGCTTTTGTTTGTTTGAAAATTCACTTTGTTGTTTTCTTTGGTTTCTTTACTCTCTTTTTTTCAGGTTGACCTGATAACCACTTTCACAAAACTG
AGTACCTTGGGCCAACAAATCAACTATGAGGCATATACATATCCTCCCCCAAAGATCGACATTACCAAACTCAAATTGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTGTCTCCTTCCTCTCAACTTGCCCTTCTCTGCTTCCACTCGTTGCTTATGATACACCACCCTCCGCCAGATACCAACCTCGTTCAGTGTCCATTTGTTGTAATAAAACCATAAGC
GATGTTAGTGATGGAGAGCCGTTCCATTGGAGAAGGAGAGATGTTCTCAAATGCGCCGGGGCAACCGTTGGCCTG
GAATTAATTGGAAGCTCCGGATCTCTTGTTGAAATGGCTAATGCT
GCTGACCTGATACAGCGCAGACAGCGTTCTGAATTTCAAT
CTAAGATTAAGGAAACACTTTTTACAGCCATAAAGGGAAATCCTGATCTTATTCCATCCTTACTGACACTGGCTCTAAAT
GATGCTTTGACTTATGATAAG
GCAACAAAATCAGGTGGTCCAAATGGCTCTATACGGTTCAGCTCAGAAATAGGTAGACCAGAAAATACAGGGCTTTCAGCAGCCTTGAATTTATTAGAG
GAAGCCAAAAAGGAAATAGACTCAGATTCCAAAGGTGGATCCATTTCCTATGCAGATCTGATTCACATTGCAG
CACAAAGTGCTGCCAAGGCTACATTTTTAGCTGCTGCCATTCGCAAA
TGCGGTGGAAAAGAGGAGAAAGGGAAAACACTGTACAATGCATACGGATCAAATGGACAG
TGGGGTTTGTTCGATAGACAATTTGGTAGGGCTGATGCTCAAGACCCAGATCCAGAGGGA
AGAGTTCCACTATGGGAGAAGGCAAGTGTACAGGAAATGAAAGACAAGTTTGTTGCTGTAGGCTTTGGTCCTCGCCAG
CTGGCTGTTTTATCTGCATTCTTAGGTCCTGATCAAAATGCA
ACAGAAACCTTATTGGCCAGTGATCCTGATGTTGCTCCATGGGTTCAGAAATACCAACGGAGCCGTGAAACTGTCTCTCAGACAGATTATGAG
GTTGACCTGATAACCACTTTCACAAAA
CTGAGTACCTTGGGCCAACAAATCAACTATGAGGCATATACATATCCTCCCCCAAAGATCGACATTACCAAACTCAAATTGTAA

Retrieve as FASTA