Entry information : GmPrx124 (Glyma03g01010.1)
Entry ID 8944
Creation 2011-07-04 (Qiang Li)
Last sequence changes 2011-11-28 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-11-19 (Christophe Dunand)
Peroxidase information: GmPrx124 (Glyma03g01010.1)
Name (synonym) GmPrx124 (Glyma03g01010.1)
Class Class III peroxidase    [Orthogroup: Prx019]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmPrx124
start..stop
S start..stop
MtPrx88 401 8e-142 20..310 20..312
GmPrx125 398 1e-140 7..309 5..310
PtPrx38 395 9e-139 9..309 6..307
GmPrx308 390 3e-137 2..309 1..317
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 743181..743375 195 N° 2 741776..742519 744  
complement(join(741776..742519,743181..743375))


exon

Literature and cross-references GmPrx124 (Glyma03g01010.1)
DNA ref. Phytozome 12:   Gm03 (743375..741776)
Protein sequence: GmPrx124 (Glyma03g01010.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   312 (292)
PWM (Da):   %s   34221.33 (31859.0) Transmb domain:   %s   i5-27o
PI (pH):   %s   8.58 (8.40) Peptide Signal:   %s   cut: 21 range:21-312
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVKFTIVVIFLFFMFPIAFADLRVGFYSSSCPRAEQIVGQVVQRRFNRDRSITAALLRMHFHDCFGCDASILIDSTRGNQSEKAAGANGTVRGYELIDEIKKALERECPSTVSCADIITLATRDSVVLAGGLKYDVATGRRDGHVSQSSEVNLPGPRSTVSRVLEVFSANGMSLDEMVTLLGAHTVGFTHCSFFRDRLNDPNMDPSLRAGLGRTCNRPNSDPRAFLDQNVSSSMVFDNAFYKQIVLRRGVLFIDQQLALDTLSKGLVTVFAGNNAAFQRSFADAMVKMGNIKVLVGNEGEIRRNCRVFNSAS*

Retrieve as FASTA  
Remarks Complete sequence from genomic (intron 1). Incorrect prediction from phytozome (5' end is missing).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTGAAGTTCACAATTGTTGTTATCTTCTTGTTCTTTATGTTTCCCATTGCATTTGCTGATCTTAGGGTTGGATTCTATAGCTCTAGCTGCCCAAGAGCAGAGCAAATTGTGGGTCAA
GTTGTTCAGAGGAGATTCAACCGTGATAGATCTATTACTGCTGCCTTGCTTCGCATGCACTTCCATGACTGCTTT
GTCAGAGTAAGACACAAACCACTCTCAATCATCACATTGCTTTAC
TAACCACTCTTGTCTTTTCGGGGTTCAACACTAGATTTAATTCTTTTAGGGGAGGAATTTGATCCATTCACCCATTAATTCAGTTGATTCGGAAGAAAATTGGATGGTTAATTTAAACCT
TGAGTACATATTGATTTGTCTATGTGCATATCTTAAATCACCAACTTTAAGCTATATATAATTCAATCTAGCTATGCTTGCTTTTTCGGTAGAAGTATGTTGAATGTCAATCTATGGATT
TGGTTTACTCACTTTTTTTTTCTTTTTTTTTTTAACCATTGAATCTAGTTTTTTCTTTAATGAGCTAAAAATATTAAAAATAATTGTGGCAGTGCAACCCACCTTATATCTCTCAAAGCG
CATTAAAATGCATTGAAAAGTGGATTAAGGTAAAATGAAACACACTGTTAATTAATAGAAAGAAATAGAAGAAAGTGTAATAAAATTATACTTTAATAGTTAATTGCATTATTTAAATTA
TTTCACATAAGATGAGTTTTCATTTTATATTTTTATTATATTTAATATACCTCTTTTTTCTTCCTTTATCATAAAAGCATTTAAATCTCAATAATAATTTTTTACTAATTGTATTTGATT
CACAAATTGGATTCAGGGCTGTGACGCGTCCATATTAATAGACTCAACCAGGGGCAATCAATCTGAAAAAGCTGCAGGAGCAAACGGCACCGTTCGGGGATACGAGCTAATAGACGAAAT
AAAAAAAGCCTTAGAAAGAGAATGTCCATCAACGGTTTCATGCGCCGATATAATCACCCTGGCCACACGTGATTCCGTGGTCCTAGCAGGTGGGCTCAAATACGACGTCGCAACGGGAAG
GCGTGACGGACACGTGTCGCAATCCTCCGAAGTGAACCTGCCGGGGCCACGATCCACTGTGTCGCGGGTGTTGGAAGTCTTCAGCGCAAACGGCATGTCGTTGGACGAAATGGTTACTCT
CTTGGGGGCCCACACCGTAGGTTTTACGCACTGCAGTTTCTTCCGAGACAGGCTCAACGACCCCAACATGGACCCTTCTTTGCGGGCCGGGTTGGGCCGGACTTGCAACAGGCCCAACAG
TGACCCAAGGGCGTTTTTGGACCAAAACGTGTCGTCGTCGATGGTGTTCGACAATGCGTTTTACAAGCAGATTGTTCTGAGGAGAGGGGTGCTTTTCATCGACCAGCAATTGGCCTTGGA
CACTTTGTCGAAAGGGTTGGTCACAGTTTTTGCGGGGAATAATGCGGCTTTTCAAAGGAGTTTTGCAGATGCTATGGTGAAGATGGGGAACATTAAGGTTTTGGTAGGGAATGAGGGAGA
GATTAGGAGAAATTGTAGGGTTTTTAACAGTGCTTCCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTGAAGTTCACAATTGTTGTTATCTTCTTGTTCTTTATGTTTCCCATTGCATTTGCTGATCTTAGGGTTGGATTCTATAGCTCTAGCTGCCCAAGAGCAGAGCAAATTGTGGGTCAA
GTTGTTCAGAGGAGATTCAACCGTGATAGATCTATTACTGCTGCCTTGCTTCGCATGCACTTCCATGACTGCTTT
GGCTGTGACGCGTCCATATTAATAGACTCAACCAGGGGCAATCAA
TCTGAAAAAGCTGCAGGAGCAAACGGCACCGTTCGGGGATACGAGCTAATAGACGAAATAAAAAAAGCCTTAGAAAGAGAATGTCCATCAACGGTTTCATGCGCCGATATAATCACCCTG
GCCACACGTGATTCCGTGGTCCTAGCAGGTGGGCTCAAATACGACGTCGCAACGGGAAGGCGTGACGGACACGTGTCGCAATCCTCCGAAGTGAACCTGCCGGGGCCACGATCCACTGTG
TCGCGGGTGTTGGAAGTCTTCAGCGCAAACGGCATGTCGTTGGACGAAATGGTTACTCTCTTGGGGGCCCACACCGTAGGTTTTACGCACTGCAGTTTCTTCCGAGACAGGCTCAACGAC
CCCAACATGGACCCTTCTTTGCGGGCCGGGTTGGGCCGGACTTGCAACAGGCCCAACAGTGACCCAAGGGCGTTTTTGGACCAAAACGTGTCGTCGTCGATGGTGTTCGACAATGCGTTT
TACAAGCAGATTGTTCTGAGGAGAGGGGTGCTTTTCATCGACCAGCAATTGGCCTTGGACACTTTGTCGAAAGGGTTGGTCACAGTTTTTGCGGGGAATAATGCGGCTTTTCAAAGGAGT
TTTGCAGATGCTATGGTGAAGATGGGGAACATTAAGGTTTTGGTAGGGAATGAGGGAGAGATTAGGAGAAATTGTAGGGTTTTTAACAGTGCTTCCTAA

Retrieve as FASTA