Entry information : SbPrx10 (Sobic.001G293100.1 [2.1] / Sb01g028620 [1.4])
Entry ID 896
Creation 2008-10-28 (Christophe Dunand)
Last sequence changes 2008-10-28 (Christophe Dunand)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2014-08-04 (Christophe Dunand)
Peroxidase information: SbPrx10 (Sobic.001G293100.1 [2.1] / Sb01g028620 [1.4])
Name (synonym) SbPrx10 (Sobic.001G293100.1 [2.1] / Sb01g028620 [1.4])
Class Class III peroxidase    [Orthogroup: Prx033]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation N/D
Tissue type Seedlings
Inducer Phosphate starvation
Repressor N/D
Best BLASTp hits
Perox score E-value SbPrx10
start..stop
S start..stop
ZmPrx105 617 0 1..327 1..325
ZmPrx142 610 0 1..327 1..326
PviPrx02 592 0 1..327 1..324
SiPrx162 573 0 1..327 1..325
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 49913124..49913354 231 N° 2 49913492..49913671 180 N° 3 49914017..49914179 163 N° 4 49914977..49915386 410
join(49913124..49913354,49913492..49913671,49914017..49914179,49914977..49915386 )


exon

Literature and cross-references SbPrx10 (Sobic.001G293100.1 [2.1] / Sb01g028620 [1.4])
Literature Cordonnier-Pratt,M.-M. et al., unpublished
DNA ref. Phytozome 12:   chromosome_1 (49913124..49915386)
EST ref. GenBank:   CF429563 [3' end]
Protein sequence: SbPrx10 (Sobic.001G293100.1 [2.1] / Sb01g028620 [1.4])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   327
PWM (Da):   %s   35008.4 Transmb domain:   %s   i9-31o
PI (pH):   %s   6.41
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MQPACARSAALLAALVVVLAYSAVSCRGQLANNYYAGKCGNSSVEDIIHDAVKARLAWDKRMVAGLLHLQFHDCFVAGCDASILLDGPNTEKTAPENSGIFGYDFIDDVKTALERVCPGVVSCADIIIAATRDAVGMCGGPSYQVQLGRRDGMVSQASMASILPGPNVDVPTAIDLFGRKGINALEMVSLMGAHTVGVTHCSVIHNRLFDYKGTGLPDPAMDPMYVWILTTYACPKGQAFDNIVYLDDPSSILLVDKSYYSQIMKRHGVLSVDQALGDHNATAWMVNFLATTDFFPSMFSHALNKLAALDVLTGTAGEIRKNCRRTN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 1, 3 introns) and 2 ESTs. Incorrect prediction from phytozome, exons 1 and 2 are missing.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGCCGGCCTGCGCGCGCTCCGCCGCGCTGCTCGCCGCCTTGGTCGTCGTGCTGGCTTATTCAGCCGTGAGCTGCCGCGGTCAGCTGGCTAACAACTACTACGCCGGCAAGTGCGGC
AACTCCAGCGTGGAGGACATCATCCACGACGCCGTCAAGGCCCGCCTCGCGTGGGACAAGAGGATGGTCGCCGGCCTCCTCCACCTGCAGTTCCACGACTGCTTCGTCGCT
GTACGTACT
ACGCAAACACCATCATTGTCTTGCTAGCTAGCTAGCTTCTTCAATATATCATCTATCGATATCGATCCATCTCAGTTTCAACATTATTGATTGATTTATTTGTTGCTGAATATATATTTG
TAATGAAGGGGTGCGACGCGTCGATCCTGCTGGACGGGCCAAATACGGAGAAGACAGCGCCGGAGAACAGTGGCATCTTCGGCTACGACTTCATCGACGACGTCAAGACGGCGCTGGAGA
GAGTATGCCCCGGCGTCGTCTCCTGTGCTGACATCATCATCGCCGCGACAAGGGACGCCGTTGGCATG
GTGAGTCACCCGGCCCCATTTGTATGCTATATATGCTACGATCGAGCTGCGA
ACAAGCAACAATGCTGCCGATTGATCTTTGTTTTGAGGAATCGCAATGCATGCCATATGATGATTGACTTCATTTGCTCCTTGCCATATGATGATTTATTTTTGGTCTTTGCTAAGAGCA
GCAGACAGTTGCTTCAATCTTTAATTATTCATTATTACTATAGGGAGCCTACATCACATGCATTGTTAATACTTTTGTTGTTTTACTAGCTATTTACAAAATGATGATTTATTTGCATTT
GAACAAAGTATTAACGCGCGTATTAATCTGCGTGTACAACAATGCAAGTCCAGTGCGGAGGGCCGAGCTACCAAGTACAACTGGGCAGAAGAGACGGCATGGTGTCACAAGCGTCAATGG
CGAGCATTCTGCCGGGCCCCAACGTCGACGTCCCCACCGCTATCGATCTATTCGGACGGAAGGGCATCAACGCCCTCGAGATGGTCAGCCTAATGG
GTACGTCGCCGCCTATGCTACGAT
GATGCAATTTTTATTTTAATGCAGAAAACGAGACATACGTAAAAATTTAGCGAAAGATCGATACAGTGCGTACGTATACCGGATTTACTGGCCACACAGTACAACTTGTGTTGAAAGTTT
TACCATGAACCACGTGCATGCATGTCCTCTCTTCGCTAACATGAAGCAGGCTGGTTTTAATAAATAAATTAGCCTCTTTTGACCTAGAACACAGCTAAGCGTATTGATTCGATGTGCAGA
TATCTAGCAGCTCAACACATGGAATATCACGTACACGGTACACAAGTGTTGGCACATAAAATAAACAGTCAGTATATTTAGATATGCGTTAATTTATTGAGCTAGTTTGCTGGTCTAACG
TTATAAGCACTTGTGATCTTAGTACAAATATTATTATATTTATATTATGTTATTTCCCTTTTCAATATGTAACCCGATGCATGATCACTACCCAGCTCCTCATCAAACCGTTAGGAATCA
TATGTAAATGCTGAATATAAGTTCTTCTGATCGAGGTCTCGGACTTAGAGCACACAGGTAACATTAAATGAGTTATCCACGCCCACACACAAATTACACTTGGCAGCATTAATACTACAA
TGCAACTGATGCGATACAGTTTGCTTATAATTTGCGAGATGAATCTTTTAAGCCTAATTAGTTATTAGACAATATTTATCAAATACAAATAAATGCTACAGTGTTTATTTTGTAAATTTT
TTTTGTAATTAAACAAGGCCTACAACTCAATCTCATGCATTGTTTTGTTGCAGGCGCGCACACAGTGGGGGTGACACACTGCTCCGTGATCCACAACCGGCTGTTCGACTACAAAGGCAC
TGGCTTGCCGGACCCGGCCATGGACCCGATGTACGTGTGGATCCTGACGACGTACGCGTGCCCTAAGGGCCAGGCCTTCGACAACATCGTCTACCTGGACGACCCCTCCAGCATCCTCCT
CGTCGACAAGAGCTACTACTCGCAAATCATGAAGCGCCATGGCGTGCTGTCCGTGGACCAGGCTCTCGGCGACCACAACGCCACCGCGTGGATGGTGAACTTCCTCGCCACCACCGACTT
CTTCCCCTCCATGTTCAGCCACGCGCTCAACAAGCTCGCCGCACTCGACGTCCTGACCGGCACCGCCGGCGAGATCAGGAAAAACTGCCGGAGGACCAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGCCGGCCTGCGCGCGCTCCGCCGCGCTGCTCGCCGCCTTGGTCGTCGTGCTGGCTTATTCAGCCGTGAGCTGCCGCGGTCAGCTGGCTAACAACTACTACGCCGGCAAGTGCGGC
AACTCCAGCGTGGAGGACATCATCCACGACGCCGTCAAGGCCCGCCTCGCGTGGGACAAGAGGATGGTCGCCGGCCTCCTCCACCTGCAGTTCCACGACTGCTTCGTCGCT
GGGTGCGAC
GCGTCGATCCTGCTGGACGGGCCAAATACGGAGAAGACAGCGCCGGAGAACAGTGGCATCTTCGGCTACGACTTCATCGACGACGTCAAGACGGCGCTGGAGAGAGTATGCCCCGGCGTC
GTCTCCTGTGCTGACATCATCATCGCCGCGACAAGGGACGCCGTTGGCATG
TGCGGAGGGCCGAGCTACCAAGTACAACTGGGCAGAAGAGACGGCATGGTGTCACAAGCGTCAATGGCG
AGCATTCTGCCGGGCCCCAACGTCGACGTCCCCACCGCTATCGATCTATTCGGACGGAAGGGCATCAACGCCCTCGAGATGGTCAGCCTAATGG
GCGCGCACACAGTGGGGGTGACACAC
TGCTCCGTGATCCACAACCGGCTGTTCGACTACAAAGGCACTGGCTTGCCGGACCCGGCCATGGACCCGATGTACGTGTGGATCCTGACGACGTACGCGTGCCCTAAGGGCCAGGCCTTC
GACAACATCGTCTACCTGGACGACCCCTCCAGCATCCTCCTCGTCGACAAGAGCTACTACTCGCAAATCATGAAGCGCCATGGCGTGCTGTCCGTGGACCAGGCTCTCGGCGACCACAAC
GCCACCGCGTGGATGGTGAACTTCCTCGCCACCACCGACTTCTTCCCCTCCATGTTCAGCCACGCGCTCAACAAGCTCGCCGCACTCGACGTCCTGACCGGCACCGCCGGCGAGATCAGG
AAAAACTGCCGGAGGACCAACTGA

Retrieve as FASTA