Entry information : GmPrx168 (Glyma08g17850.1)
Entry ID 8968
Creation 2011-07-04 (Qiang Li)
Last sequence changes 2011-12-14 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-11-28 (Qiang Li)
Peroxidase information: GmPrx168 (Glyma08g17850.1)
Name (synonym) GmPrx168 (Glyma08g17850.1)
Class Class III peroxidase    [Orthogroup: Prx022]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmPrx168
start..stop
S start..stop
GmPrx270 679 0 1..383 1..384
MtPrx82 560 0 2..383 3..389
VvPrx90 464 1e-164 1..383 1..375
RcPrx72 458 2e-162 66..383 23..354
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 13311621..13311965 345 N° 2 13312492..13312689 198 N° 3 13313440..13313605 166 N° 4 13314055..13314230 176
N° 5 13314279..13314545 267  
join(13311621..13311965,13312492..13312689,13313440..13313605,13314055..13314230 ,13314279..13314545)


exon

Literature and cross-references GmPrx168 (Glyma08g17850.1)
DNA ref. Phytozome 12:   Gm08 (13311621..13314545)
EST ref. GenBank:   EV265428.1 [5' end]
Protein sequence: GmPrx168 (Glyma08g17850.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   383 (362)
PWM (Da):   %s   42428.27 (40136.9) Transmb domain:   %s   i5-22o
PI (pH):   %s   5.74 (5.45) Peptide Signal:   %s   cut: 22 range:22-383
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRSCIINLWIVAALVVPVLLSLRSPRGETQTQTTSSFSDSSTFSLKLANGFGFYAVSFPFNQRIRDGSNLEYDFYRDTCPQAEGVVRSALTRIYFDHRDVAPALLRLFFHDCFIEGCDASLLLDENNGDRNRSVEKQAVPNQTLRGFDKIELIKEEVEQACPGIVSCADILALAARDSILLAGGPFYPVLTGRRDSHQSFFEEATDQIPRPDDNVTRTLNLFNLRGFNARETVSLLGGHNIGKIGCDFIQQRLYNFQGTGQPDPSIPLDFLRQMRLNCPDSKNSSTSIDEFTISALSSSVSSGASFDTHYYQSLLRGRGLLFADQQLMAEQKTARLVSAYASDDGSTFRMDFARVMLKMSNLDVLTGLQGQVRVNCSLPVSS*

Retrieve as FASTA  
Remarks Complete sequence from genomic and 1 EST. Incorrect prediction from Phytozome (Both 5' end and 3' end are missing).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGAAGCTGCATCATCAACCTCTGGATCGTGGCGGCACTCGTCGTCCCCGTGCTCCTCTCTCTCAGAAGCCCTCGAGGCGAAACCCAAACCCAAACCACTTCTTCTTTCTCCGATTCT
TCTACCTTTTCTTTGAAGCTTGCAAATGGATTTGGCTTCTATGCTGTCTCTTTCCCTTTCAACCAAAGGATACGTGATGGGTCCAATCTCGAATACGATTTCTATAGGGACACGTGTCCC
CAAGCGGAGGGTGTTGTTCGTTCGGCGCTCACTCGCATATACTTCGACCACAGGGACGTTGCACCTGCTCTGCTTCGTCTCTTCTTCCACGATTGCTTCATCGAG
GTCCTTCTTTTTTTT
TTGTGGGGTTGCTTTTTTTGTTTTTTTTTGTTTTTATAAAGTTTTGTGCTTTGTGTTGAAACCGAAATGGGGCGTCTTTTGTTTTTCCCTTTCTTGCGTCCAAGACCATGAATTTGGAGT
ATTTGTTGTGTTTATTCAAATGTGTGTTTCTTGATTACTTGCTTTTTTTCCCTTAAGATTTTCTTGATTCCTTCTTCTGACTATGCTGTTTGTGCTTTGAATAATGAATAATGAATATCC
TGAATATTGATCATGATCTTGTGCTATTATGTAGATCGTTGATTTTCACTTTTTCTTTATAGAGTTTAATTTTTATGTGTAGAAACCCTTATACCGTCAATTAATTAGAAATTACGACTG
ATATGAATTTTAAAGTAATTATTAAGAAGGTTAATAATCTTACGGTTCATGTTAATTTATGATTGAATTACATTTTAATTAAATTGTTTTTTATGCATGTAAACAATCTCTTAATATACT
TTTTGTTGCATTTGGGGTGTTGCTGAATCAGGGGTGTGATGCTTCTTTGCTGTTGGATGAGAACAATGGTGATAGAAACCGTTCGGTGGAGAAGCAGGCTGTGCCAAATCAGACATTGAG
AGGTTTTGACAAAATTGAGCTGATAAAAGAAGAGGTGGAACAAGCATGTCCCGGGATTGTGTCTTGTGCTGACATACTTGCTCTTGCAGCAAGAGATTCCATTCTTCTG
GTACATATTTC
TTTGTTTCCAATTGACTTGGATTGGGACTATACTGTATCTTGAGTTTCAGTTTACGTTGATAGTTTAGGATTTGTTGTTCTGATTGTAGTAAGGATGGCAGATGGAGAGTTTGGGTGTTA
AATTGAAGATCTGAATTCTGATGCATTTTGACTTCAATTGCAAGTTTGGAACCTGTAAATGCTACATGGCTTGGTCCTGTTTCTCTGTCCTGAAACTTATTAGCCATCAAAATAATATAA
CAAAAAGTAAAACAATAATGATGTTTTGATAATATTTCTGGACTGGTTTATTGCTTCATTTGTTTTTTTTTTAAAACTGAAATACCATCTTTTACTAGCCAAGTAGTGATGCCTAGTTCA
TTTTCATGCTATCATTCTCACATGAATATTTCACGGGGAAAGCCAGTTAGAAACAAGTTTACTAAATCATTTGAATTCAACTTTGTTCTGATTCTCTTTCCAGCAACTGCTTGTTGGTTT
GTTGCAAGTTTGTCTTGACTCATTTGTTTCGTCTCTCTTTATGTTACTTTTGTCCTTGTTCAATCATGTGTCTATATATTATTCATGCATGTCCTTGATAAGATAAGCAAGTGCATAATT
TTTCCTTGAACTTGACATATTGATATTATGATTTGAGGTAGCAAAGTTTTCAAGAATATCTACTTTTGCTGTTATATTACACTTCTTAGAAGTTCAGCATCATTGTACCTATGATATGTT
TTGTGGATCTCCATGGCAGGCTGGTGGACCTTTCTATCCAGTTTTAACAGGAAGAAGGGATAGCCATCAATCATTTTTTGAGGAAGCAACTGATCAGATTCCCAGACCTGATGATAACGT
TACACGCACACTAAATCTCTTCAATCTCAGAGGATTCAATGCAAGAGAAACAGTCAGCCTTCTTG
GTACTTACTCTACATTTCTTGTATCAGTCTAAATATATGTAATTTTCGGTCCCCA
TTCTTAATAAGTTGTAATCTAGTTCTCATCATTTTTTTTTGTTTCTTTCTTTATATAGTTTGGCAGTCTCACTATTAGTTTTTTGTTTATTTTGTCCACTAAGTGTGTGTCTTGCTTGCA
TTTTGGTCACTCTAAATATTATTAGGATACCAAATGAAAACCTATGATTAGTAGGATCAAAAAGTAAGTAAAGCCAACACTTATTGTCATGTGATCCATAGANNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTTTTCAGCGTCATCCATGAATAGAATCTGACTAAC
AAGGTGCATTGGTTTGTCTGTTGATGATGTGCAGGAGGACACAACATTGGCAAAATCGGCTGCGACTTCATTCAGCAAAGGCTGTACAACTTTCAAGGCACAGGACAACCAGACCCCAGC
ATCCCCCTCGATTTCCTTCGCCAGATGAGGCTAAACTGCCCAGACAGCAAGAACAGCAGCACCAGCATAGACGAGTTTACGATCTCAAAG
CCAGTGAGCAGTGATTTCCACTCCAAAATG
GGGATGTCATACATGCAGGCACTGTCATCTTCAGTGTCATCAGGAGCATCATTTGACACTCACTACTACCAGAGCCTGCTAAGAGGAAGAGGGCTTCTTTTCGCGGATCAGCAGCTGATG
GCCGAGCAGAAAACCGCCAGATTGGTCTCTGCTTATGCTTCAGATGATGGATCAACCTTTCGAATGGACTTTGCTAGGGTCATGTTGAAAATGTCTAACCTTGATGTTCTAACTGGACTT
CAAGGTCAGGTTCGAGTCAATTGCTCACTACCTGTGTCTTCTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGAAGCTGCATCATCAACCTCTGGATCGTGGCGGCACTCGTCGTCCCCGTGCTCCTCTCTCTCAGAAGCCCTCGAGGCGAAACCCAAACCCAAACCACTTCTTCTTTCTCCGATTCT
TCTACCTTTTCTTTGAAGCTTGCAAATGGATTTGGCTTCTATGCTGTCTCTTTCCCTTTCAACCAAAGGATACGTGATGGGTCCAATCTCGAATACGATTTCTATAGGGACACGTGTCCC
CAAGCGGAGGGTGTTGTTCGTTCGGCGCTCACTCGCATATACTTCGACCACAGGGACGTTGCACCTGCTCTGCTTCGTCTCTTCTTCCACGATTGCTTCATCGAG
GGGTGTGATGCTTCT
TTGCTGTTGGATGAGAACAATGGTGATAGAAACCGTTCGGTGGAGAAGCAGGCTGTGCCAAATCAGACATTGAGAGGTTTTGACAAAATTGAGCTGATAAAAGAAGAGGTGGAACAAGCA
TGTCCCGGGATTGTGTCTTGTGCTGACATACTTGCTCTTGCAGCAAGAGATTCCATTCTTCTG
GCTGGTGGACCTTTCTATCCAGTTTTAACAGGAAGAAGGGATAGCCATCAATCATTT
TTTGAGGAAGCAACTGATCAGATTCCCAGACCTGATGATAACGTTACACGCACACTAAATCTCTTCAATCTCAGAGGATTCAATGCAAGAGAAACAGTCAGCCTTCTTG
GAGGACACAAC
ATTGGCAAAATCGGCTGCGACTTCATTCAGCAAAGGCTGTACAACTTTCAAGGCACAGGACAACCAGACCCCAGCATCCCCCTCGATTTCCTTCGCCAGATGAGGCTAAACTGCCCAGAC
AGCAAGAACAGCAGCACCAGCATAGACGAGTTTACGATCTCAAAG
GCACTGTCATCTTCAGTGTCATCAGGAGCATCATTTGACACTCACTACTACCAGAGCCTGCTAAGAGGAAGAGGG
CTTCTTTTCGCGGATCAGCAGCTGATGGCCGAGCAGAAAACCGCCAGATTGGTCTCTGCTTATGCTTCAGATGATGGATCAACCTTTCGAATGGACTTTGCTAGGGTCATGTTGAAAATG
TCTAACCTTGATGTTCTAACTGGACTTCAAGGTCAGGTTCGAGTCAATTGCTCACTACCTGTGTCTTCTTAA

Retrieve as FASTA