Entry information : GmPrx170 (Glyma08g19180.1)
Entry ID 8970
Creation 2011-07-04 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-12-16 (Christophe Dunand)
Peroxidase information: GmPrx170 (Glyma08g19180.1)
Name (synonym) GmPrx170 (Glyma08g19180.1)
Class Class III peroxidase    [Orthogroup: Prx007]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmPrx170
start..stop
S start..stop
GmPrx05 617 0 1..325 1..325
GmPrx256 559 0 1..325 1..322
PvPrx04 558 0 1..325 1..325
LjPrx07 532 0 1..325 1..326
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 14477092..14477487 396 N° 2 14477910..14478072 163 N° 3 14478592..14479010 419  
join(14477092..14477487,14477910..14478072,14478592..14479010)


exon

Literature and cross-references GmPrx170 (Glyma08g19180.1)
DNA ref. Phytozome 12:   Gm08 (14477092..14479010)
Protein sequence: GmPrx170 (Glyma08g19180.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   326 (301)
PWM (Da):   %s   34680.55 (31969.1) Transmb domain:   %s   i5-27o
PI (pH):   %s   7.06 (6.98) Peptide Signal:   %s   cut: 25 range:25-325
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MEARSLYSLVFLVLALAIVNTVHGQGTRVGFYSSACPLAESIVKSTVTTHVNSDSTLAAGLLRMHFHDCFVQGCDASVLIAGSGTERTAFANLGLRGFEVIDDAKTQLEATCPGVVSCADILALAARDSVVHSGGLSYQVPTGRRDGRISQASDVSNLPAPFDSVEVQTQKFTAKGLNTQDLVTLVGAHTIGTTACQFFSNRLYNFTANGPDPSIDPSFLPQLQSLCPQNGDGSKRVALDTGSQTKFDLSYYSNLRNSRGILQSDQALWSDASTKTTVQRYLGLIKGLLGLTFNVEFGKSMIKMGNIELKTGTDGEIRKICSAIN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 2 and 3).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGGCGCGTAGTTTGTACTCACTAGTGTTTCTTGTGCTTGCTTTGGCTATTGTGAACACAGTGCATGGCCAAGGGACGCGTGTAGGGTTCTATTCGAGTGCATGTCCACTTGCTGAG
TCCATTGTTAAGTCCACAGTTACAACCCACGTTAACTCTGATAGTACTTTGGCTGCTGGGTTGCTTCGGATGCACTTCCATGATTGCTTTGTGCAAGGTTGTGACGCTTCTGTTCTCATT
GCTGGTTCTGGCACTGAGAGAACAGCATTTGCAAACCTTGGTTTACGAGGATTTGAGGTTATTGATGATGCTAAGACGCAGCTCGAGGCTACATGCCCCGGTGTTGTGTCTTGTGCTGAT
ATCCTTGCTCTTGCTGCTCGTGATTCCGTTGTTCAC
GTAATTAATCAACTCAAATTCTATCCATTTTTTATTTATGTAGCTAGTGCAAATAATTAATGTTAAAATCATACTTGGAGAATT
TTATTAATTAGTTGAATCAATTTGCAGGTTGGCGAGTTTAATATATATGTATATATAGAGATAGGGGGATTAGTGTCTATGCACTAATAATTTAAAATAATTTTATCATGTCATTCAAAT
AACTCAAATTTTGAATTATTTTAGTATAATTTATAATCATTTTAAATATTAATAAATTTATTATATATAATAAGATTATGATTAAATAATTGTGTAAAAAAATTTACACGGTGATATATA
GTTTTTTCTCATATGTATATTTATTTATATTTGTATGTCATGCTTATAATATATAATGAGTTTATAATTAATTAAAATTTGGCATTTTTGCATGGCAGAGTGGTGGACTGAGTTATCAAG
TGCCTACTGGACGCAGAGATGGACGCATATCACAGGCTTCAGATGTCAGTAACTTGCCTGCTCCTTTTGACTCTGTTGAAGTTCAAACACAAAAGTTCACAGCAAAGGGACTCAACACTC
AAGACCTCGTCACCCTTGTTG
GTAATTACGCTTACACACATATAAGTTTGTTTACACACTTCAAGTCAATGAATTGATCATATATAATTACAATATCACATCGAACTTATACTGTCACAT
ACTAGTACTATATATCACGGTTGCTTTGTGACAGCTCAGTTCTAACTATAGGTAGTGGCAAAATGCAAATAGAATGACTTCACGTTAACTTTAATTTGTTGACTTTTTCAGTTTTTTTAT
TACACTTTCTTATGTAACGCGCATTAGAAAAACATCTTTTTCCTGCTTATTTTTCTATCATTGTCTAGTGATATGGCATTTTTTAAAAGGGTGTTTGATAAAAATTGAACGCTGCTTTTC
AATGGATATTAAAAAGAAAGTACAAACAAAAGTGCCAAGGAAAAATCAACAATCAAATTAACTGTATTCAACAGTATCTTTTATATATGAAAACAAAAGTATATACTATATGAAATTAAG
ATACAAGTTGACAATACAAATTTGAATTAATGGATTTTATTTTTGTGAATGTATATATAGGTGCACATACCATTGGTACTACAGCTTGCCAGTTCTTCAGTAACAGATTGTACAACTTCA
CCGCAAATGGTCCTGACCCTTCCATCGACCCTTCATTTCTTCCTCAACTACAATCACTATGCCCTCAAAACGGTGACGGTTCAAAACGAGTAGCGCTAGATACGGGTAGTCAAACTAAAT
TTGATTTATCTTACTATAGTAATTTGAGGAATTCGCGTGGAATTCTGCAATCTGATCAAGCACTTTGGAGTGATGCTTCCACAAAGACAACTGTTCAGAGGTATTTGGGCTTGATAAAAG
GCTTGCTTGGATTAACATTTAACGTGGAATTTGGAAAGTCTATGATAAAGATGGGCAACATTGAGTTGAAGACTGGTACTGATGGTGAAATTCGCAAGATATGTTCTGCCATCAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGGCGCGTAGTTTGTACTCACTAGTGTTTCTTGTGCTTGCTTTGGCTATTGTGAACACAGTGCATGGCCAAGGGACGCGTGTAGGGTTCTATTCGAGTGCATGTCCACTTGCTGAG
TCCATTGTTAAGTCCACAGTTACAACCCACGTTAACTCTGATAGTACTTTGGCTGCTGGGTTGCTTCGGATGCACTTCCATGATTGCTTTGTGCAAGGTTGTGACGCTTCTGTTCTCATT
GCTGGTTCTGGCACTGAGAGAACAGCATTTGCAAACCTTGGTTTACGAGGATTTGAGGTTATTGATGATGCTAAGACGCAGCTCGAGGCTACATGCCCCGGTGTTGTGTCTTGTGCTGAT
ATCCTTGCTCTTGCTGCTCGTGATTCCGTTGTTCAC
AGTGGTGGACTGAGTTATCAAGTGCCTACTGGACGCAGAGATGGACGCATATCACAGGCTTCAGATGTCAGTAACTTGCCTGCT
CCTTTTGACTCTGTTGAAGTTCAAACACAAAAGTTCACAGCAAAGGGACTCAACACTCAAGACCTCGTCACCCTTGTTG
GTGCACATACCATTGGTACTACAGCTTGCCAGTTCTTCAGT
AACAGATTGTACAACTTCACCGCAAATGGTCCTGACCCTTCCATCGACCCTTCATTTCTTCCTCAACTACAATCACTATGCCCTCAAAACGGTGACGGTTCAAAACGAGTAGCGCTAGAT
ACGGGTAGTCAAACTAAATTTGATTTATCTTACTATAGTAATTTGAGGAATTCGCGTGGAATTCTGCAATCTGATCAAGCACTTTGGAGTGATGCTTCCACAAAGACAACTGTTCAGAGG
TATTTGGGCTTGATAAAAGGCTTGCTTGGATTAACATTTAACGTGGAATTTGGAAAGTCTATGATAAAGATGGGCAACATTGAGTTGAAGACTGGTACTGATGGTGAAATTCGCAAGATA
TGTTCTGCCATCAACTAG

Retrieve as FASTA