Entry information : GmPrx182 (Glyma09g06350.1)
Entry ID 8974
Creation 2011-07-04 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-12-16 (Christophe Dunand)
Peroxidase information: GmPrx182 (Glyma09g06350.1)
Name (synonym) GmPrx182 (Glyma09g06350.1)
Class Class III peroxidase    [Orthogroup: Prx020]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmPrx182
start..stop
S start..stop
GmPrx266 620 0 1..328 1..328
GmPrx16 543 0 23..328 21..324
GmPrx233 542 0 1..328 1..324
PvPrx18 530 0 25..328 23..324
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 5109865..5110080 216 N° 2 5109209..5109406 198 N° 3 5108006..5108171 166 N° 4 5107038..5107444 407
complement(join(5107038..5107444,5108006..5108171,5109209..5109406,5109865..5110 080))


exon

Literature and cross-references GmPrx182 (Glyma09g06350.1)
DNA ref. Phytozome 12:   Gm09 (5110080..5107038)
Protein sequence: GmPrx182 (Glyma09g06350.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   329 (303)
PWM (Da):   %s   36543.46 (33712.0)  
PI (pH):   %s   8.01 (8.40) Peptide Signal:   %s   cut: 26 range:26-328
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MEDTSFFVILSSFLLLIVSTQTSSAQLTRGFYRNTCPNVEQLVRSAVEQKFQQTFVTAPATLRLFFHDCFVRGCDASILLASPNNKAEKNHPDDISLAGDGFDTVVKAKAAVDSDPQCRNKVSCADILALATRDVINLAGGPFYEVELGRLDGRISTIASVQRQLPHPDFNLDKLNSMFSFHGLTKTDMIALSGAHTIGFSHCNHFSRRIYNFSPQKLIDPTLNLQYAFQLRQACPLRVDSRIAINMDPVTPEKFDNQYFKNLQQGMGLFTSDQVLATDERSRGTVNLFASNEQAFNKAFIEAITKMGRIGVKTGRQGEIRFDCSRVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAAGATACTAGCTTCTTTGTGATCTTATCATCCTTTCTGCTTCTCATAGTTAGTACACAAACAAGCTCAGCTCAACTTACTCGTGGCTTCTATCGAAACACGTGCCCCAATGTGGAA
CAGTTGGTTCGTTCAGCTGTGGAGCAGAAGTTCCAGCAAACCTTTGTGACTGCCCCTGCCACTCTTAGACTCTTCTTCCATGATTGCTTTGTGAGG
GTGTGTAAGCCTATCTATTTCATG
ACTTCATGGCATCATCATTATCATTTATCACACTAATTATATTTGGTGCTGATTGAGTTCAAATGACTACTTGCATGCTCATTTTGCATTCACTAATGCACACAAAACATAGGACAAACA
AAACTTAGATATAGTTTCCTAAGTGCTTTTGGTACTATTCTCTAAATGGAATTGGAGTTTCACTTCTATAATTTGAGTTATAAAGATTTCCATTAAGTGACAACACCAATTTCTGATTGG
AGAATAACACCAAAGACACCTATGAATTTGTATCTATGTTTCGTCCCAAAACATATGGGTTGGTATAAGTATGAAAATGCAAGAGCCCTTATATAATTTGTGCATGTATCATATTTATTT
ATTGTTCAATGATTTTAATTTACAAGGATTTTGAAAATGTTACTGTTACTTATATTGGTTTTATTTCTGGTCAGGGTTGTGATGCTTCCATTTTGCTTGCATCTCCAAACAACAAGGCAG
AGAAAAATCATCCTGATGACATTTCACTAGCTGGGGATGGCTTTGACACAGTTGTTAAAGCCAAGGCAGCGGTTGATAGTGACCCTCAATGCAGAAACAAAGTCTCTTGTGCTGATATTC
TTGCTCTGGCTACTAGAGATGTGATAAATTTG
GTATGATAAAATACTTGATGTTACGGATAAAATACTTCTATATTGGTATGGTAAATTTGGTATGATAAAATACTTGAAGTTACTGATA
AAATACTTCTATATTGGTATGGTAAATTTGGTATGATAAAATACTTGAAGTTACTGATAAAATACTTCTATATTGGTATGGTAAATTTGGTATGATAAAATACTTGAAGTTACTGATAAA
ATACTTCTATATTGGTATGGTAAATTTGGTATGATAAAATACTTGAAGTTACTGATAAAATACTTCTATATTGGTATGGTAAATTTGGAATCATATTACATTGCTATGATTTGCTACTTG
AAGTTACTGATGAAATACTTCTATATTTTACCTCTAATCTAAATTCTGATATAGAGCAGAGACGGCAAACTGAAACAAAGGTGAAACGATTCTATATGATGTTCTTAGTCTTATCCATAA
ATAGCCAAGCTCTAACTAATATTCTACAAGAATTTAATTAGAATACGCTATAAAGGTTTTTTCTTTACTGTCTTTCTATCATGAATGGTCATTAATTGATAATTATCCATTTTTGTAATA
ATTATTTTAAAATTCATATTTAAAGTAATTTTTAATTTATTGATGGTGTAAAAATCCTTGCAATGATTGCATATCAAAGTTAAACACATTTTACAATGCCTTCTGAGTCTAAGTACTGAT
ATTCAACTATATTATTTCTTTCTTTTCATTATAATTATTGTGTAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAGTTATA
TCCTGTATATTAAGATTAACTACAAAATCTAAAGATGAATCAATGATGGTGTAACGTTAACTTTATAAATTATTATTCTTTTTCATTGATTTGTTACATTTTCTTGATATGTGTAGAACA
AACTACAAGGACAATTATTTTAGGAGAGAGGTAGTATATATGCTTAACATTTTTCAATATGCTAACCCAGCAACACATTATCTAACAGTCCTGCAATTGCGTAATGTAGGCTGGGGGACC
ATTTTATGAAGTTGAATTGGGAAGGCTTGACGGAAGAATATCTACTATTGCTAGTGTTCAACGCCAGCTTCCTCACCCTGATTTCAATTTAGATAAGCTCAATTCCATGTTTAGCTTCCA
TGGCCTCACAAAGACAGATATGATTGCCTTATCAG
GTAACTTCACTAACACAAAGTGACAAGGTTCTGTTGTTTCATTAATCAAACAAAATGATTAAACTATGAATTTAATTAAAATGCA
TCGAGTTTTGCTATGGTGTTCGCCACAGGATACAAAAAAAATGGCGTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTT
AGTGTCTCATTATTTATAGTGTTAAGGAGTCTAAATTGGCGGGAAAGTTAGTTAAGCCATGTGTCATTATTGAGCCAACCTGTCATGTATTAGATTGGTGTCCTTTATATTGATTCTGAG
GTTAAACATCAATGCTGAGTAACCCATTACAAGTGTCATCCAATAACATATTATCATGTATGATAAATTTGTTGATTTTTATCTAATCAATTTAAAACTTGTAATTAGAATGATTTCTGA
TTGATCGACGGTATAAATATCTTTATGCCAGTGCATGAACAATAAACTCTTAAACTACATTTTTATTTTTTATTTTTTTAATTTATATTTTTAAAAAATGATGTGTTTTGTGTTAGGTGC
ACATACAATTGGATTCTCTCACTGCAACCATTTCTCAAGACGGATCTACAACTTCAGCCCCCAAAAATTAATTGACCCAACACTTAACTTACAATATGCCTTCCAACTTAGACAGGCTTG
CCCTCTCAGAGTTGATTCTAGAATTGCCATAAACATGGACCCTGTCACACCTGAAAAGTTTGACAACCAATACTTCAAGAATCTCCAGCAAGGAATGGGCCTATTCACTTCTGATCAGGT
GCTGGCTACAGATGAAAGGTCAAGGGGCACAGTCAACTTATTTGCATCAAATGAACAAGCTTTTAACAAAGCTTTTATTGAAGCTATTACTAAAATGGGAAGGATAGGTGTTAAAACAGG
TAGACAAGGGGAAATAAGGTTTGATTGCTCCAGGGTGAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAAGATACTAGCTTCTTTGTGATCTTATCATCCTTTCTGCTTCTCATAGTTAGTACACAAACAAGCTCAGCTCAACTTACTCGTGGCTTCTATCGAAACACGTGCCCCAATGTGGAA
CAGTTGGTTCGTTCAGCTGTGGAGCAGAAGTTCCAGCAAACCTTTGTGACTGCCCCTGCCACTCTTAGACTCTTCTTCCATGATTGCTTTGTGAGG
GGTTGTGATGCTTCCATTTTGCTT
GCATCTCCAAACAACAAGGCAGAGAAAAATCATCCTGATGACATTTCACTAGCTGGGGATGGCTTTGACACAGTTGTTAAAGCCAAGGCAGCGGTTGATAGTGACCCTCAATGCAGAAAC
AAAGTCTCTTGTGCTGATATTCTTGCTCTGGCTACTAGAGATGTGATAAATTTG
GCTGGGGGACCATTTTATGAAGTTGAATTGGGAAGGCTTGACGGAAGAATATCTACTATTGCTAGT
GTTCAACGCCAGCTTCCTCACCCTGATTTCAATTTAGATAAGCTCAATTCCATGTTTAGCTTCCATGGCCTCACAAAGACAGATATGATTGCCTTATCAG
GTGCACATACAATTGGATTC
TCTCACTGCAACCATTTCTCAAGACGGATCTACAACTTCAGCCCCCAAAAATTAATTGACCCAACACTTAACTTACAATATGCCTTCCAACTTAGACAGGCTTGCCCTCTCAGAGTTGAT
TCTAGAATTGCCATAAACATGGACCCTGTCACACCTGAAAAGTTTGACAACCAATACTTCAAGAATCTCCAGCAAGGAATGGGCCTATTCACTTCTGATCAGGTGCTGGCTACAGATGAA
AGGTCAAGGGGCACAGTCAACTTATTTGCATCAAATGAACAAGCTTTTAACAAAGCTTTTATTGAAGCTATTACTAAAATGGGAAGGATAGGTGTTAAAACAGGTAGACAAGGGGAAATA
AGGTTTGATTGCTCCAGGGTGAACTGA

Retrieve as FASTA