Entry information : GmPrx185 (Glyma09g27390.1)
Entry ID 8976
Creation 2011-07-04 (Qiang Li)
Last sequence changes 2011-10-12 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-12-13 (Qiang Li)
Peroxidase information: GmPrx185 (Glyma09g27390.1)
Name (synonym) GmPrx185 (Glyma09g27390.1)
Class Class III peroxidase    [Orthogroup: Prx036]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmPrx185
start..stop
S start..stop
GmPrx73 631 0 1..325 1..325
MtPrx13 531 0 1..325 1..322
GmPrx77 518 0 24..325 21..322
MePrx90 497 4e-179 17..325 15..323
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 34200651..34200875 225 N° 2 34201548..34201736 189 N° 3 34202705..34203268 564  
join(34200651..34200875,34201548..34201736,34202705..34203268)


exon

Literature and cross-references GmPrx185 (Glyma09g27390.1)
DNA ref. Phytozome 12:   Gm09 (34200651..34203268)
Protein sequence: GmPrx185 (Glyma09g27390.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   325 (297)
PWM (Da):   %s   35681.4 (32550.7)  
PI (pH):   %s   8.47 (8.21) Peptide Signal:   %s   cut: 29 range:29-325
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MALLPYSKCKFLFPIIFLSLTLSSMSQAELDAHYYDKTCPQAEKIISDTVLRASTFDPKVPARILRIFFQDCFIRVCDASILLDSTPKNLAEKDGPPNLSVHAFYVIDEAKAKLEKACPRTVSCADLIAIAARDVVALSGGPYWNVLKGRKDGRVSKASETVNLPAPTLNVNQLIQSFAKRGLGVKDMVTLSGGHTLGFSHCSSFQARIHNFSLLHDIDPSLNTEFALDLKKKCPKPNTNFSAGQFLDSTASVFDNDYYRQLLVGKGLFSSDQSLVGDQRTSWIVKAFAKDQSLFFKEFADSMLKLGNVGVSENGEVRLNCKVVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCTTCTGCCATATTCAAAATGCAAATTTCTTTTTCCAATCATTTTCCTCTCCTTGACATTATCATCAATGTCACAAGCAGAGCTTGATGCTCACTACTATGATAAAACATGTCCA
CAAGCAGAGAAGATAATTTCAGACACTGTTCTCAGGGCTTCCACATTTGATCCAAAAGTTCCAGCTAGGATCTTAAGGATCTTCTTCCAAGACTGTTTCATAAGG
GTAAGAAATACTACC
TTCATTTCATATCTATTAATGTTTAAAGCTTACACAAATTAAGGAGTATTTAATGGGTGTATAATGCATTATTATTATATTTGGACTAAAATAACCTTATTTTGGTTATGTTTGGTTACT
GATTTTGAAAACAGTTTTTTTTTTTCTAAAATTTGTTTGTTTCTTGAGCACATTTAACAGTGTTTGTCCTTTAAACATATTTTTATTTTCTAAAAGTTTGTTTTTTGAACACTTCGACAA
AGCACTTGAAGAAAATAGGAGAGAATAAGAAAACACCTCTCAGTTATTTTTTGTTTTTTTTTTATTTATTTTATATTTAAAACAATTATTTCATAAACAGTTTTCAAAACTCAACAGATT
TTGGATGAAAAATTGATTGCTGAGTAGGGCAAACTTGTTTTAAAAAATCAGTTTGTAAAACAAAAAAGTGAGAAGAAGAAATACACCCTTAATATCTCATTTATTTGTGATAAATTACTA
TTAAGCAACTGCTGGAAAGGAGTATAAACAACAACAAAAAAAAGACTGAGTTTGTAAAATATCAATAGTTTTGAAAAAGAACAAGGACATGGAATGCAACCTGATTAATGCTTTATTGAT
TCATGTGAAATATTGAAATGGATTTAATTGTATGTTTTGGTCAATTGTGAATGATAGGTATGTGATGCATCAATATTGCTGGACTCAACACCCAAAAACCTGGCTGAGAAAGATGGTCCT
CCTAATCTCTCTGTCCATGCTTTCTATGTTATTGATGAAGCCAAGGCCAAGCTTGAGAAAGCTTGCCCTCGCACGGTTTCCTGTGCTGACTTAATAGCCATTGCGGCTAGGGATGTGGTA
GCATTG
GTAATAACTCAATTAAGCCTTCAAGCTATTTTAGAACTGCTAAATTCTTGCTTGGCACTTATAAGAGTCATCTGGTATTCTAGTACTGTATCTTGATTCTCTGTATGGTAAATA
TTTATATGGCAGATCATAAAATTTTATATTAGACCAATATTAATTCAGAATATTTTTACACTCCTCAAGTCTCACTATTACTACACCCGTTCGTTTATGATAAAAAAAAAGGATGAGAGG
AGTAAATGATAATTATCTTTTAATACTCTTTTCAGTTACATTTCATCTTAGCCATTCATCATTTACTTAACTATTTCTATTTTCAAGATAAAATTATTTAATGAATGGTGATTAAGTGTA
AGGAAAAGATCTAAAAGAAACCAGTGTGGTTCTAATGTAACGTAGGGTATAACAGAGACATTTTTGTTTCAATAATAAGAATCCATACTCTTAAAAAGTTTCTTCATGTTCTATATATTA
CCATCAATCATTCCTAAGAATCTTAAACTTCAACTAGTAGTCTCTATTGCTTCTATTTAAAATTATATTATTTTCCATCTTTTTTTCTTCAAATTTATCCATTGCTTTATAAAATATAAT
TTTTAACTACACAATTTTTCTTCATATTTTCAATAATTAAGATAAAACCTTAATTTTAGAATAATAATTCTGAGTGTTTATACTTTAATAAAATGAAGTTATGTTTTTTATGATTGATTA
GACTATTTAATAGCCTCACAAGTCACATTATAATGACCTTAGACGATAAATATTTCAAGACTAATTAATGCAGAGTATAATTACCCAAGATAATGTTAGTAGTATAGTACATATTGCTTT
CTATAGTTGAATAATGATTCTTCCATGAATCATCAACTTTGTCAAAGGATGTTAAATTAGGGAGGATACAACTTGTTTTATGTTGTAATGATCATTGATCAATATATATATTAATAACTC
ATAACTTTTCCCAGTCTGGAGGACCATATTGGAATGTGCTAAAAGGAAGAAAAGATGGAAGGGTCTCAAAGGCATCTGAAACAGTCAACCTACCAGCTCCAACCCTAAATGTGAACCAAC
TCATTCAGAGCTTTGCAAAGAGAGGTTTAGGTGTCAAAGACATGGTGACTCTCTCTGGTGGCCACACTCTTGGCTTTTCACACTGTTCTTCTTTCCAAGCTAGAATTCACAACTTCAGTT
TGTTGCATGACATTGACCCTAGTTTGAACACTGAGTTTGCACTAGACCTCAAAAAGAAGTGTCCAAAACCAAACACAAACTTCAGTGCTGGCCAGTTCCTGGACTCAACAGCATCAGTGT
TTGACAATGACTACTATAGACAATTGTTGGTGGGAAAGGGTTTGTTCTCATCAGATCAGTCACTTGTTGGGGATCAGAGAACTAGTTGGATTGTTAAAGCATTTGCCAAGGACCAAAGTT
TGTTCTTCAAAGAGTTTGCGGATTCAATGTTGAAACTTGGAAATGTGGGGGTGTCTGAAAATGGAGAAGTGAGACTTAATTGCAAGGTTGTGAATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCTTCTGCCATATTCAAAATGCAAATTTCTTTTTCCAATCATTTTCCTCTCCTTGACATTATCATCAATGTCACAAGCAGAGCTTGATGCTCACTACTATGATAAAACATGTCCA
CAAGCAGAGAAGATAATTTCAGACACTGTTCTCAGGGCTTCCACATTTGATCCAAAAGTTCCAGCTAGGATCTTAAGGATCTTCTTCCAAGACTGTTTCATAAGG
GTATGTGATGCATCA
ATATTGCTGGACTCAACACCCAAAAACCTGGCTGAGAAAGATGGTCCTCCTAATCTCTCTGTCCATGCTTTCTATGTTATTGATGAAGCCAAGGCCAAGCTTGAGAAAGCTTGCCCTCGC
ACGGTTTCCTGTGCTGACTTAATAGCCATTGCGGCTAGGGATGTGGTAGCATTG
TCTGGAGGACCATATTGGAATGTGCTAAAAGGAAGAAAAGATGGAAGGGTCTCAAAGGCATCTGAA
ACAGTCAACCTACCAGCTCCAACCCTAAATGTGAACCAACTCATTCAGAGCTTTGCAAAGAGAGGTTTAGGTGTCAAAGACATGGTGACTCTCTCTGGTGGCCACACTCTTGGCTTTTCA
CACTGTTCTTCTTTCCAAGCTAGAATTCACAACTTCAGTTTGTTGCATGACATTGACCCTAGTTTGAACACTGAGTTTGCACTAGACCTCAAAAAGAAGTGTCCAAAACCAAACACAAAC
TTCAGTGCTGGCCAGTTCCTGGACTCAACAGCATCAGTGTTTGACAATGACTACTATAGACAATTGTTGGTGGGAAAGGGTTTGTTCTCATCAGATCAGTCACTTGTTGGGGATCAGAGA
ACTAGTTGGATTGTTAAAGCATTTGCCAAGGACCAAAGTTTGTTCTTCAAAGAGTTTGCGGATTCAATGTTGAAACTTGGAAATGTGGGGGTGTCTGAAAATGGAGAAGTGAGACTTAAT
TGCAAGGTTGTGAATTGA

Retrieve as FASTA