Entry information : GmPrx197 (Glyma10g36380.1)
Entry ID 8985
Creation 2011-07-04 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-12-26 (Christophe Dunand)
Peroxidase information: GmPrx197 (Glyma10g36380.1)
Name (synonym) GmPrx197 (Glyma10g36380.1)
Class Class III peroxidase    [Orthogroup: Prx012]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmPrx197
start..stop
S start..stop
GmPrx53 632 0 1..323 1..323
GmPrx209 572 0 1..323 1..323
MtPrx110 557 0 1..323 1..321
MtPrx76 551 0 1..323 1..320
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 44563270..44563485 216 N° 2 44563002..44563193 192 N° 3 44562731..44562896 166 N° 4 44562254..44562651 398
complement(join(44562254..44562651,44562731..44562896,44563002..44563193,4456327 0..44563485))


exon

Literature and cross-references GmPrx197 (Glyma10g36380.1)
DNA ref. Phytozome 11:   Gm10 (44563485..44562254)
Protein sequence: GmPrx197 (Glyma10g36380.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   324 (298)
PWM (Da):   %s   34619.35 (31895.9)  
PI (pH):   %s   7.22 (7.24) Peptide Signal:   %s   cut: 26 range:26-323
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAYRTSSITSSLVTLVLLGTILCDAELSSTFYDSACPIALSTIRTVIRSAVSAERRMAASLIRLHFHDCFVQGCDASILLDDSSSIESEKSALQNANSIRGYNIIDQAKSEVEKLCPGVVSCADIVAVAARDASFAVGGPSWTVKLGRRDSTTASKSSATSDLPRFTDDLDTLISRFNNKGLTARDMVTLSGAHTIGQAQCFTFRGRIYNNASDIDAGFASTRQRGCPSVSNDDNDKKLASLDLVTPNSFDNNYFKNLIQKKGLLQSDQVLFSGGSTDSIVSEYSNKPTTFKSDFAAAMIKMGDIQPLTASAGIIRKICSSIN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). Incorrect prediction from phytozome (5' end is missing).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTATAGAACTTCTAGTATCACAAGTTCGTTAGTCACATTGGTGCTGTTAGGCACAATATTATGTGATGCAGAATTGTCTTCTACGTTTTACGACAGTGCTTGCCCCATTGCACTC
AGCACCATAAGAACTGTGATTCGCAGTGCAGTATCTGCGGAGCGCCGCATGGCTGCGTCTCTCATTCGCCTTCATTTTCATGATTGCTTTGTTCAG
GTACATATATGTTGATTTATTAAT
TGCATGCGTGTGCTTAATTAACTTGTTAATCCTAATTCGAACCATATTGCAGGGTTGTGACGCATCAATTTTGCTTGATGATAGCTCCTCTATTGAGAGCGAAAAGAGTGCACTTCAGAA
TGCAAACTCAATAAGGGGATATAACATCATCGATCAAGCAAAATCTGAGGTGGAGAAACTATGCCCCGGAGTTGTGTCATGTGCTGACATTGTAGCAGTAGCAGCACGTGATGCATCATT
TGCT
GTAAGTCACTGTAACAAACTAGCTAGCTATATATACGTTAATTAATTTCATGGTTTTAATTAACTTGATAATTAACATGCATTTTTTTTAAAAATTATTGATTAGGTGGGAGGTCC
ATCATGGACTGTGAAGCTTGGACGAAGAGATTCAACCACTGCAAGCAAAAGTTCGGCTACTAGTGACCTTCCACGATTCACAGACGATCTTGACACTCTTATCTCCAGATTCAATAATAA
GGGTCTCACTGCCAGAGACATGGTTACTCTATCCG
GTAACTACTTAATCATCAAGCTTCACAATTTTGACTTAGACAATTATTAAACAAATATATGTTATGAAAACATATGCAGGTGCCC
ACACAATCGGACAAGCTCAATGCTTCACATTTCGTGGAAGAATATACAACAATGCAAGTGATATTGATGCAGGATTTGCTAGCACTCGCCAACGTGGTTGTCCATCCGTTAGTAATGATG
ATAATGACAAGAAATTGGCATCACTAGACTTGGTCACACCCAATTCTTTCGACAACAACTACTTCAAGAATTTGATTCAGAAGAAGGGTCTTCTTCAATCAGATCAAGTTCTGTTTAGTG
GAGGATCTACAGATTCTATTGTGTCCGAATACAGCAATAAGCCTACAACCTTTAAGTCCGACTTCGCAGCTGCTATGATTAAAATGGGAGATATTCAACCATTAACTGCTTCAGCTGGAA
TCATAAGAAAGATTTGCAGCTCTATCAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTATAGAACTTCTAGTATCACAAGTTCGTTAGTCACATTGGTGCTGTTAGGCACAATATTATGTGATGCAGAATTGTCTTCTACGTTTTACGACAGTGCTTGCCCCATTGCACTC
AGCACCATAAGAACTGTGATTCGCAGTGCAGTATCTGCGGAGCGCCGCATGGCTGCGTCTCTCATTCGCCTTCATTTTCATGATTGCTTTGTTCAG
GGTTGTGACGCATCAATTTTGCTT
GATGATAGCTCCTCTATTGAGAGCGAAAAGAGTGCACTTCAGAATGCAAACTCAATAAGGGGATATAACATCATCGATCAAGCAAAATCTGAGGTGGAGAAACTATGCCCCGGAGTTGTG
TCATGTGCTGACATTGTAGCAGTAGCAGCACGTGATGCATCATTTGCT
GTGGGAGGTCCATCATGGACTGTGAAGCTTGGACGAAGAGATTCAACCACTGCAAGCAAAAGTTCGGCTACT
AGTGACCTTCCACGATTCACAGACGATCTTGACACTCTTATCTCCAGATTCAATAATAAGGGTCTCACTGCCAGAGACATGGTTACTCTATCCG
GTGCCCACACAATCGGACAAGCTCAA
TGCTTCACATTTCGTGGAAGAATATACAACAATGCAAGTGATATTGATGCAGGATTTGCTAGCACTCGCCAACGTGGTTGTCCATCCGTTAGTAATGATGATAATGACAAGAAATTGGCA
TCACTAGACTTGGTCACACCCAATTCTTTCGACAACAACTACTTCAAGAATTTGATTCAGAAGAAGGGTCTTCTTCAATCAGATCAAGTTCTGTTTAGTGGAGGATCTACAGATTCTATT
GTGTCCGAATACAGCAATAAGCCTACAACCTTTAAGTCCGACTTCGCAGCTGCTATGATTAAAATGGGAGATATTCAACCATTAACTGCTTCAGCTGGAATCATAAGAAAGATTTGCAGC
TCTATCAACTAA

Retrieve as FASTA