Entry information : GmPrx209 (Glyma11g10750.1)
Entry ID 8988
Creation 2011-07-04 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-12-26 (Christophe Dunand)
Peroxidase information: GmPrx209 (Glyma11g10750.1)
Name (synonym) GmPrx209 (Glyma11g10750.1)
Class Class III peroxidase    [Orthogroup: Prx012]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmPrx209
start..stop
S start..stop
GmPrx53 592 0 1..323 1..323
GmPrx197 582 0 1..323 1..323
MtPrx76 563 0 1..323 1..320
MtPrx110 556 0 1..323 1..321
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 7638568..7638783 216 N° 2 7638921..7639112 192 N° 3 7639251..7639416 166 N° 4 7639728..7640125 398
join(7638568..7638783,7638921..7639112,7639251..7639416,7639728..7640125)


exon

Literature and cross-references GmPrx209 (Glyma11g10750.1)
DNA ref. Phytozome 11:   Gm11 (7638568..7640125)
Protein sequence: GmPrx209 (Glyma11g10750.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   324 (298)
PWM (Da):   %s   34983.63 (32128.1) Transmb domain:   %s   i5-22o
PI (pH):   %s   8.31 (8.39) Peptide Signal:   %s   cut: 26 range:26-323
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAYRTLSITSFVIFILVLLGTICDAKLSSTFYDNTCPDALSTIRTVIRRAVSKERRMAASLIRLHFHDCFVQGCDASILLDDSTSIESEKTALQNVNSVRGFNVIDQAKTEVEKVCSGVVSCADIMAVAARDASFAVGGPSWTVKLGRRDSTTASKSLASSDLPLFTDDLDTLISRFNSKGLTARDMVTLSGAHTIGQAQCFTFRGRIYNNASDIDAGFASTRRRGCPSLNNNDNNKKLAALDLVTPNSFDNNYFKNLIQKKGLLQSDQVLYSGGSTDSIVSEYSKNPTTFKSDFAAAMIKMGDIEPLTGSAGMIRKICSSIN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). Incorrect prediction from phytozome (5' end is missing).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTATAGAACTTTAAGTATCACAAGTTTTGTAATATTCATACTTGTGTTGCTAGGCACAATATGTGATGCAAAATTGTCATCAACATTTTATGACAATACATGCCCCGATGCACTT
AGCACAATCAGAACTGTGATTCGTAGAGCAGTTTCTAAGGAACGCCGCATGGCTGCTTCTCTCATACGCCTTCATTTTCACGATTGTTTTGTTCAG
GTATACGTACGTTATGATTAATTA
ATTTATTAATTGCATGCACTTAACTTGATTAATCTTAATTAATTTGGATCATGTGTTGTGTTAGTAGAATCATAAACAGTAACTGGGGATCCTACTCGTATGCATTATTGCAGGGTTGTG
ATGCATCAATTTTGCTTGACGATAGCACCTCTATCGAGAGCGAAAAGACTGCGCTTCAGAATGTTAACTCAGTAAGAGGATTTAATGTCATCGATCAAGCAAAAACTGAGGTGGAGAAAG
TATGTTCCGGAGTGGTGTCATGTGCTGACATTATGGCAGTAGCAGCACGAGATGCATCATTTGCT
GTAAGTTTAAGTCAAAAAAAAAAACTTGCTATATTTATTTGATGCTTTTTTCCTT
AACTTAATAACATGCAAAAGCATATATGGTAGTAATATTTAATGACTTAATTATGCATTTTGTTATTAATTCTTGATGAGCAGGTGGGTGGTCCATCATGGACTGTGAAACTTGGACGAA
GAGATTCTACCACCGCAAGCAAAAGTTTAGCTTCTAGTGACCTTCCACTTTTTACAGACGATCTTGACACTCTCATCTCTAGATTCAATAGCAAGGGACTCACTGCCAGAGACATGGTTA
CTCTATCTG
GTAATTAATTAATTAATCATATACTCATATTGCTTGTATATGTATCTACCAAAAATTAATACTTATAATTTTTAGGCTTAATATGTTTTAATATATTAATTAACTGATGAC
AAAAATTCAAAATAAAAAAATTTAATATATGTGAAATATTCAATGCAACCAGAAAGTTTATTAAAAATCTAAAATAAAAATAAATAATTTATTATAAACCTGAAATATATTTAAGCCTNN
NNNNNNNNNNNNNNNNNNNNNNNNAATTAAGTGTGGGACAATTATTAAAGGAATTATATATGTTTTCTTAATGCTTGCAGGTGCCCACACAATTGGACAAGCTCAATGCTTCACATTTCG
TGGAAGGATATACAACAATGCAAGTGACATTGATGCAGGATTTGCTAGCACTCGTAGACGTGGTTGTCCTTCCCTCAATAACAATGATAATAATAAGAAATTGGCAGCACTGGACTTGGT
GACGCCCAATTCATTTGATAACAACTACTTCAAGAATTTGATTCAAAAGAAGGGACTTCTTCAATCAGATCAAGTTCTATATAGTGGAGGATCTACAGATTCTATTGTGTCTGAGTACAG
CAAAAATCCAACAACTTTTAAGTCTGACTTCGCTGCTGCTATGATAAAAATGGGAGATATTGAACCATTAACTGGATCAGCTGGAATGATAAGAAAGATATGTAGCTCTATAAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTATAGAACTTTAAGTATCACAAGTTTTGTAATATTCATACTTGTGTTGCTAGGCACAATATGTGATGCAAAATTGTCATCAACATTTTATGACAATACATGCCCCGATGCACTT
AGCACAATCAGAACTGTGATTCGTAGAGCAGTTTCTAAGGAACGCCGCATGGCTGCTTCTCTCATACGCCTTCATTTTCACGATTGTTTTGTTCAG
GGTTGTGATGCATCAATTTTGCTT
GACGATAGCACCTCTATCGAGAGCGAAAAGACTGCGCTTCAGAATGTTAACTCAGTAAGAGGATTTAATGTCATCGATCAAGCAAAAACTGAGGTGGAGAAAGTATGTTCCGGAGTGGTG
TCATGTGCTGACATTATGGCAGTAGCAGCACGAGATGCATCATTTGCT
GTGGGTGGTCCATCATGGACTGTGAAACTTGGACGAAGAGATTCTACCACCGCAAGCAAAAGTTTAGCTTCT
AGTGACCTTCCACTTTTTACAGACGATCTTGACACTCTCATCTCTAGATTCAATAGCAAGGGACTCACTGCCAGAGACATGGTTACTCTATCTG
GTGCCCACACAATTGGACAAGCTCAA
TGCTTCACATTTCGTGGAAGGATATACAACAATGCAAGTGACATTGATGCAGGATTTGCTAGCACTCGTAGACGTGGTTGTCCTTCCCTCAATAACAATGATAATAATAAGAAATTGGCA
GCACTGGACTTGGTGACGCCCAATTCATTTGATAACAACTACTTCAAGAATTTGATTCAAAAGAAGGGACTTCTTCAATCAGATCAAGTTCTATATAGTGGAGGATCTACAGATTCTATT
GTGTCTGAGTACAGCAAAAATCCAACAACTTTTAAGTCTGACTTCGCTGCTGCTATGATAAAAATGGGAGATATTGAACCATTAACTGGATCAGCTGGAATGATAAGAAAGATATGTAGC
TCTATAAACTAA

Retrieve as FASTA