Entry information : GmPrx233 (Glyma13g00790.1)
Entry ID 8992
Creation 2011-07-04 (Qiang Li)
Last sequence changes 2011-11-28 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-12-16 (Christophe Dunand)
Peroxidase information: GmPrx233 (Glyma13g00790.1)
Name (synonym) GmPrx233 (Glyma13g00790.1)
Class Class III peroxidase    [Orthogroup: Prx020]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmPrx233
start..stop
S start..stop
GmPrx16 614 0 20..324 20..324
PvPrx18 578 0 23..324 23..324
MtPrx14 555 0 24..324 23..323
GmPrx182 542 0 1..324 1..328
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 508450..508659 210 N° 2 509271..509462 192 N° 3 509645..509810 166 N° 4 509979..510385 407
join(508450..508659,509271..509462,509645..509810,509979..510385)


exon

Literature and cross-references GmPrx233 (Glyma13g00790.1)
DNA ref. Phytozome 12:   Gm13 (508450..510385)
Protein sequence: GmPrx233 (Glyma13g00790.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   325 (301)
PWM (Da):   %s   36189.41 (33594.1)  
PI (pH):   %s   9.01 (9.51) Peptide Signal:   %s   cut: 24 range:24-324
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MELLNLSSCLCFFSLLVLPISSAQLSRVFYRNTCPNVEQLVRSSVAQKFQQTFVTAPATLRLFFHDCFVRGCDASILLANGKPEKDHPDQISLAGDGFDTVIKAKEAVDRDPKCRNKVSCADILALATRDVVNLAGGPFYNVELGRRDGRISTIASVQRHLPHPDFNLDQLNSMFNFNGLSQTDMIALSGAHTIGFSHCNKFSNRIYKFSPRNRIDPTLNLQYAFQLRQMCPLRVDPRIAINMDPVTPQKFDNQYFKNLQQGKGLFTSDQVLFTDARSKATVNLFASNEGAFQKAFVDAITKLGRVGVKTGNQGEIRFDCTRPN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAACTCCTAAATTTGTCTTCTTGTCTTTGCTTCTTCTCCTTACTAGTGCTACCTATAAGCTCAGCTCAACTAAGTCGTGTCTTCTACAGGAACACATGCCCCAATGTGGAGCAGTTG
GTTCGCTCTTCTGTTGCACAGAAATTCCAACAGACTTTTGTGACTGCTCCTGCCACTCTTAGACTCTTCTTCCATGATTGCTTTGTGAGG
GTGTGTACACTCTTCTTCATCACTTTCATG
GTTTTCTTATATGCATAATAACATTACTTAGCATGTTTTGAGTTCACATGTTTCTTTATCATTATTTTGTTAATTAAAACGAAAGTTATGTGTACGTAGTTTTGCATTCAGGAACATGCA
CAAAACTATATAGGTGCTATATACAATTATATTACTCTATAATATCAGCTTAAAAAAAAATTAGTGAAATCAGACTATATATAATTGGTCAATATTATCAGCTCAAAGTCGATCCTAGTG
GTTGCTGTTGGATTTATCGGTCAGTGTTATCGGACCACGTACAGATATCCAATCTTATATAATTCATATCCTATGATGTTCAATCTTGGGACAAGGAGTGTGTATTTGAAGATCTCATAA
TATTAGTGACCAAAACAGTATATATAAATAAGACACAAGTCTATTCTCATGAGTTACCTTTTGGAGTTAAACTCAAAGTATAAGAACCCTAATGAAATTTTAGCATGCTTATCATTTAGA
CTAGAGTGTAAACAGTAGGCTTTTAAAATTACTATTGACTTTTTATTTTATTGTTGATTATTTTGTATGTAAGATGATAACAAATTTGTTTGTGCACACAGGGTTGTGATGCTTCGATTT
TGCTTGCAAATGGTAAGCCAGAGAAGGATCATCCTGATCAAATTTCTCTAGCTGGTGATGGCTTTGACACAGTGATTAAAGCCAAGGAAGCTGTTGATAGAGACCCTAAGTGCCGTAACA
AAGTCTCTTGTGCTGACATACTCGCTCTGGCTACTAGGGATGTCGTCAATTTG
GTATGATTTCATTTTCTTTTGTAATTGCATCTATTGCTTTTATTTATTTGCTTCGTTAAATTATTGA
CCATAATGACCAACAATTCTATTAGTTTACCTCTAAATCGTTTGATCAATGCACATTAAGATTTATACTGTTTGACATTGCTTTGCTAATAGTAATAACTACATAATATTAATAGGCTGG
TGGACCATTTTATAATGTTGAATTGGGAAGGCGTGACGGGAGAATATCTACTATTGCCAGCGTTCAACGCCATCTTCCTCACCCTGATTTCAATTTGGATCAGCTCAATTCCATGTTTAA
TTTTAATGGCCTATCCCAGACAGATATGATTGCATTATCAG
GTAATTTCACTGGCAAAAAAAAAAGAAGAGGTTTTGTTTTATTCAATCATACTTTTTAACTTTAAACCAAACATGTACT
AAATTATAGTAGGATAAAGAATCTTAGGTAGTTTAATTTAACTTTTTTATATAAGAAAGCCTGAAGAATCATGTGTTTAAATATGTTAGGTGCGCATACAATTGGGTTCTCTCACTGCAA
CAAATTCTCGAATCGAATCTACAAATTCAGCCCTAGAAACAGAATCGACCCAACACTGAATTTACAATATGCTTTTCAACTTAGGCAAATGTGCCCCTTAAGGGTTGATCCTAGAATTGC
CATAAACATGGACCCTGTCACGCCTCAAAAGTTTGACAACCAATACTTCAAGAATCTGCAGCAAGGAAAGGGTCTCTTCACTTCTGACCAGGTGCTGTTTACAGATGCAAGGTCAAAGGC
CACAGTCAACTTATTTGCATCAAATGAAGGAGCATTTCAGAAAGCTTTTGTTGATGCTATTACTAAGTTGGGAAGGGTTGGTGTTAAAACTGGAAATCAAGGTGAAATTAGGTTTGATTG
CACCAGGCCCAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAACTCCTAAATTTGTCTTCTTGTCTTTGCTTCTTCTCCTTACTAGTGCTACCTATAAGCTCAGCTCAACTAAGTCGTGTCTTCTACAGGAACACATGCCCCAATGTGGAGCAGTTG
GTTCGCTCTTCTGTTGCACAGAAATTCCAACAGACTTTTGTGACTGCTCCTGCCACTCTTAGACTCTTCTTCCATGATTGCTTTGTGAGG
GGTTGTGATGCTTCGATTTTGCTTGCAAAT
GGTAAGCCAGAGAAGGATCATCCTGATCAAATTTCTCTAGCTGGTGATGGCTTTGACACAGTGATTAAAGCCAAGGAAGCTGTTGATAGAGACCCTAAGTGCCGTAACAAAGTCTCTTGT
GCTGACATACTCGCTCTGGCTACTAGGGATGTCGTCAATTTG
GCTGGTGGACCATTTTATAATGTTGAATTGGGAAGGCGTGACGGGAGAATATCTACTATTGCCAGCGTTCAACGCCAT
CTTCCTCACCCTGATTTCAATTTGGATCAGCTCAATTCCATGTTTAATTTTAATGGCCTATCCCAGACAGATATGATTGCATTATCAG
GTGCGCATACAATTGGGTTCTCTCACTGCAAC
AAATTCTCGAATCGAATCTACAAATTCAGCCCTAGAAACAGAATCGACCCAACACTGAATTTACAATATGCTTTTCAACTTAGGCAAATGTGCCCCTTAAGGGTTGATCCTAGAATTGCC
ATAAACATGGACCCTGTCACGCCTCAAAAGTTTGACAACCAATACTTCAAGAATCTGCAGCAAGGAAAGGGTCTCTTCACTTCTGACCAGGTGCTGTTTACAGATGCAAGGTCAAAGGCC
ACAGTCAACTTATTTGCATCAAATGAAGGAGCATTTCAGAAAGCTTTTGTTGATGCTATTACTAAGTTGGGAAGGGTTGGTGTTAAAACTGGAAATCAAGGTGAAATTAGGTTTGATTGC
ACCAGGCCCAACTAG

Retrieve as FASTA