Entry information : GmPrx266 (Glyma15g17620.1)
Entry ID 9006
Creation 2011-07-04 (Qiang Li)
Last sequence changes 2011-11-28 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-12-16 (Christophe Dunand)
Peroxidase information: GmPrx266 (Glyma15g17620.1)
Name (synonym) GmPrx266 (Glyma15g17620.1)
Class Class III peroxidase    [Orthogroup: Prx020]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmPrx266
start..stop
S start..stop
GmPrx182 643 0 1..328 1..328
GmPrx16 541 0 23..328 21..324
GmPrx233 541 0 5..328 11..324
MtPrx14 528 0 26..328 23..323
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 14017718..14017933 216 N° 2 14017044..14017241 198 N° 3 14016413..14016578 166 N° 4 14015452..14015858 407
complement(join(14015452..14015858,14016413..14016578,14017044..14017241,1401771 8..14017933))


exon

Literature and cross-references GmPrx266 (Glyma15g17620.1)
DNA ref. Phytozome 12:   Gm15 (14017933..14015452)
Protein sequence: GmPrx266 (Glyma15g17620.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   329 (303)
PWM (Da):   %s   36480.42 (33757.0)  
PI (pH):   %s   8.33 (8.57) Peptide Signal:   %s   cut: 26 range:26-328
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGDPCFFVVLSSLLLLIVSTQTSSAQLTRGFYLNTCPNVEQLVRSAVEQKFQQTFVTAPATLRLFFHDCFVRGCDASILLASPNNKAEKDHPDDISLAGDGFDTVAKAKAAVDSDPQCRNKVSCADILALATRDVINLAGGPFYKVELGRRDGRISTIASVQRQLPHPDFNLDKLNSMFSFHGLTQTDMIALSGAHTIGFSHCNHFSRRIYNFSPKKLIDPTLNLHYAFQLRQSCPLRVDSRIAINMDPVTPQKFDNQYFKNLQQGMGLFTSDQVLATDERSRGTINLFASNEQAFYNAFIEAITKMGRIGVKTGRQGEIRFDCSRVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). Incorrect prediction from phytozome (Extra sequence at 5' end).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGAGATCCTTGCTTCTTTGTGGTCTTATCGTCCTTGCTGCTCCTCATAGTTAGTACACAAACAAGCTCAGCTCAACTTACTCGCGGCTTCTATCTAAACACATGCCCCAATGTGGAA
CAGTTGGTTCGTTCAGCTGTGGAGCAGAAATTCCAGCAGACCTTTGTGACTGCCCCTGCCACTCTTAGACTTTTCTTCCATGATTGCTTTGTGAGG
GTGTGTAAGCCTATCATTTCATGA
CTTCGTGGAATCATGATTACCATTTATCACACTAACTATAGTTGGTGCTGATTGAGTTCAAATGACTACTCTACTTACATGCATGCTCTTTTTTGCATTCACTAGTGCACACAAAATATA
GGATAAAATTAGATACAGTTTTACAAGTGCTTTTGGTGCTATTCTCTAAATAGAATTGGAGTTTCACTTCTATAATTTGTGTAATAAAGATTTCCATTAAGTGACAATGCCGATTACTGA
GGTGAAACTCTAATTCTGATTGGAGAATAACACCAAAAAACACCTGTAGAATTGTATCTAAGTTTTGTCCCAAAATATATGGGTTGGTGTAAGTATGAAAATGCAAGAGCCCTTATATAA
TTTGTGCATGTATCATATTTATTCATTTTTCAATGATTTTAATTTACAAGGATTTTGAAAATGTTACTGATATTGGTTTTATTTCTGCACAGGGTTGTGATGCTTCCATTTTGCTCGCAT
CTCCAAACAACAAGGCAGAGAAAGACCATCCTGATGATATTTCACTCGCTGGGGATGGCTTTGACACAGTTGCTAAAGCCAAGGCAGCTGTTGATAGTGACCCTCAATGCAGAAACAAAG
TCTCTTGTGCTGATATACTTGCTCTGGCTACTAGAGATGTGATAAATTTG
GTATGATAAAATACTTGAAGTTACTGATAAAATACTTCTATATTGGCATGATAAATTTGGTAACATATCA
CATTGCTATGATTTGCTACTTGAAGTTACTGATAAAATACTTCTATATTTTACCTCTAATCTAAATTCTGATATAGCAGAGACTGCAAACTGAAACAAAGGGGAAACGATTCTAGATGAT
GTTCTTAATCTTATCCATAAACAGCCAAGCTCTAAGATTCTATATGATCATGAATGCTTTGTAAAAATCATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACATTTTACAATGCTTTCCGAGTCTAAGTACTGATATTTAACTATGTTACAAGCTTAACATTTTTCAATATGCTAACCCCGCATGACAT
TAATTATCTAACAGTCCTGCAATTGCATAATGTAGGCTGGGGGACCATTTTATAAAGTTGAACTGGGAAGACGTGACGGGAGAATATCTACTATTGCCAGTGTTCAACGCCAGCTTCCTC
ACCCTGATTTCAATTTAGATAAGCTCAATTCCATGTTTAGCTTCCATGGCCTCACCCAGACAGATATGATTGCCTTATCAG
GTAACTTCACTAACACAAAGTGACAAGATTTTGTTGTTT
CATTAATCAAACAAAATGATTGAACTATGAATTTAGTTAAAATGCATTGAGTTCTGTTATGGTGTTCGCCACCAGGATATAGAAAAATGATGTGAGAGAGTGAGAGGGAGAAAGAGATAG
AGACAAGGGAGGGTTCTCTTCTGTTGCTACTAGTCCCTTTCTGTTTAGTGTGTCATTATTTATAGTGTCAAGGAGTCCGAATTGGCGGGAAAGTTAGTTATGCCATGTGTCATTATTGAG
CCGACGTGTCATGTGTTAGATTGGTGTCCTCTATATTGATTCCGAGGTTAAGCATCAATGCTAGATAACCCGAAACAAAAGTGTCATTCAATAATAAATTATTATATATGATAAGTTTTT
TTTATATAATAAATTTAAAATTCGTAATTAGAATGATTTCTGATTGATTGACTGTATAGGTATCTTTACACTCAAGTGTATGAAAAATAAATAGTTAAACAATAGTTTTTCAATTTTTTT
TTTTTTAAAAGTCTGAAAATGATATCCTGTGTTAGGTGCACATACAATTGGATTCTCTCACTGCAATCACTTCTCAAGACGGATCTACAACTTCAGCCCCAAAAAACTAATTGACCCAAC
ACTAAACTTACACTATGCCTTCCAACTTAGACAGTCTTGCCCTCTCAGAGTTGATTCCAGAATTGCCATAAACATGGACCCTGTCACACCTCAAAAGTTTGACAACCAATACTTCAAGAA
TCTCCAGCAAGGAATGGGCCTATTCACTTCTGATCAGGTGCTGGCCACAGATGAAAGGTCAAGGGGCACAATCAACTTATTTGCATCAAATGAACAAGCTTTTTACAATGCTTTTATTGA
AGCTATTACTAAAATGGGAAGGATAGGTGTTAAAACAGGAAGACAAGGTGAAATAAGATTTGATTGCTCCAGGGTTAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGAGATCCTTGCTTCTTTGTGGTCTTATCGTCCTTGCTGCTCCTCATAGTTAGTACACAAACAAGCTCAGCTCAACTTACTCGCGGCTTCTATCTAAACACATGCCCCAATGTGGAA
CAGTTGGTTCGTTCAGCTGTGGAGCAGAAATTCCAGCAGACCTTTGTGACTGCCCCTGCCACTCTTAGACTTTTCTTCCATGATTGCTTTGTGAGG
GGTTGTGATGCTTCCATTTTGCTC
GCATCTCCAAACAACAAGGCAGAGAAAGACCATCCTGATGATATTTCACTCGCTGGGGATGGCTTTGACACAGTTGCTAAAGCCAAGGCAGCTGTTGATAGTGACCCTCAATGCAGAAAC
AAAGTCTCTTGTGCTGATATACTTGCTCTGGCTACTAGAGATGTGATAAATTTG
GCTGGGGGACCATTTTATAAAGTTGAACTGGGAAGACGTGACGGGAGAATATCTACTATTGCCAGT
GTTCAACGCCAGCTTCCTCACCCTGATTTCAATTTAGATAAGCTCAATTCCATGTTTAGCTTCCATGGCCTCACCCAGACAGATATGATTGCCTTATCAG
GTGCACATACAATTGGATTC
TCTCACTGCAATCACTTCTCAAGACGGATCTACAACTTCAGCCCCAAAAAACTAATTGACCCAACACTAAACTTACACTATGCCTTCCAACTTAGACAGTCTTGCCCTCTCAGAGTTGAT
TCCAGAATTGCCATAAACATGGACCCTGTCACACCTCAAAAGTTTGACAACCAATACTTCAAGAATCTCCAGCAAGGAATGGGCCTATTCACTTCTGATCAGGTGCTGGCCACAGATGAA
AGGTCAAGGGGCACAATCAACTTATTTGCATCAAATGAACAAGCTTTTTACAATGCTTTTATTGAAGCTATTACTAAAATGGGAAGGATAGGTGTTAAAACAGGAAGACAAGGTGAAATA
AGATTTGATTGCTCCAGGGTTAACTGA

Retrieve as FASTA