Entry information : GmPrx272 (Glyma16g06030.1)
Entry ID 9008
Creation 2011-07-04 (Qiang Li)
Last sequence changes 2011-11-28 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-12-16 (Christophe Dunand)
Peroxidase information: GmPrx272 (Glyma16g06030.1)
Name (synonym) GmPrx272 (Glyma16g06030.1)
Class Class III peroxidase    [Orthogroup: Prx029]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmPrx272
start..stop
S start..stop
GmPrx56 623 0 1..326 1..327
MtPrx41 503 0 1..325 1..320
CclPrx43 488 7e-176 5..325 4..324
CsPrx20 485 1e-174 5..325 6..326
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 5484188..5484400 213 N° 2 5482879..5483070 192 N° 3 5480919..5481494 576  
complement(join(5480919..5481494,5482879..5483070,5484188..5484400))


exon

Literature and cross-references GmPrx272 (Glyma16g06030.1)
DNA ref. Phytozome 11:   Gm16 (5484400..5480919)
Protein sequence: GmPrx272 (Glyma16g06030.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   327 (302)
PWM (Da):   %s   34881.28 (32125.9)  
PI (pH):   %s   4.54 (4.43) Peptide Signal:   %s   cut: 25 range:25-326
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MEKSMRMVLMALLAFTMLLSKGEGQLVENFYSLSCPNVESIVKQAVTNKFTQTITTGQATLRLFFHDCFVEGCDASVIISSPNGDAEKDAEENISLPGDGFDTVIKAKQAVESSCPGVVSCADILALATRDVIGLLGGPSFNVELGRKDGLISKASSVEGNLPKANFNLDQLNALFSKHGLSQTDMIALSGAHTVGFSHCDQFANRLYSFSSSNTVDPTLDPSYAQDLMAGCPRNPDPTVAVALDPQSPAAFDNLYYQNLLSGKGLLTSDQVLFEDATSQPTVVRFANNVADFNDAFVAAIRKLARVGVKTGNDGEIRRDCTTFNS*

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 1 and 2). Incorrect prediction from phytozome (Short 5' end is missing).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGAAAAGCATGAGGATGGTATTAATGGCTTTGTTGGCTTTCACGATGCTTTTATCTAAGGGTGAAGGCCAATTAGTAGAGAATTTCTACAGTTTATCTTGTCCAAACGTGGAATCC
ATCGTGAAACAAGCAGTGACTAACAAGTTTACACAGACCATTACAACTGGACAAGCAACTCTGCGTCTCTTTTTCCATGATTGCTTTGTTGAG
GTGTGTTCTTCAATTCTTATAATGTTT
CTTTATTTCTTCACTTGTGTACTCGTGTGTATATGATATGATTTTTCAGTTTCAAGTTTTGTTTTTATAAAAAAAATATATACATTCATCATGGTCGATTAAAGGATAAAACAATTAAAA
CATAAACTTTAAGCCCTTTAACAAAAATATATTTCCTTTTAGTTTTTATAAAGCACAAAATGTCGCATTTATTAGAAAAAAAAAGACTATTTTTTATTAAAAATAAAATTTTTACCTTAA
AATTTATTTTAAATCTCATTTGACATTAGGTCAGCCCTAGCTCCATATCTATGGTTGTTCGTTTCCTTCCTCTGATAATGAGCATGCATTTTCTAGACATGATAGTTTCCCTGAGTTTGC
TCTCTCTCTCTTTTAAAATTTCATATATGAAGTTGAACTTTCAAAATATATGATCGTGACTTTTCTGGCTGGTGGAGGCTTATTCTTCTTTTTGCAATTTCGCTTGGAATGGTAATATGG
TATGCGCCACTTTCTATTCTGTGTGTGGAAATAATAATGATAATATGATGCGAGTGAGACCTAGAAGCTGTTTGGATAAGCTTTTTAAATATTTCTNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCCAAACAGACCCGTAGTCACATACCACACACAACTTCACGCCTTTGGTGCCTACCTAGATTATTAAA
AAAATAAAAAATCATTGACTACGAGGTATATGCGACAATCCTATTAGTTGATGTGTTGTTAACTTTTGACCAGCTACAGTTATCACAGGAACATGCTAAAAACATTGATCAAGAACCCAT
TCTATTTCATTCAGGAAATAAAATTACAGCAATGTTAACCAAAAGGGCAATTAAACATGAGATCCACAAAATTGGTGATTGTGAAAATTGGCTTGACTATTCTTATGAAAAATGAATTTT
GATGGTGTAGGGTTGTGATGCCTCAGTGATAATCTCGTCGCCAAATGGGGACGCAGAGAAGGATGCAGAGGAGAATATTTCACTACCAGGAGATGGGTTTGACACTGTCATCAAGGCAAA
GCAAGCAGTGGAATCTTCATGTCCTGGAGTGGTTTCATGTGCAGACATTTTGGCACTTGCTACCAGAGACGTTATAGGCTTG
GTAAGCAAATATTAATTATTAATTTAACATACATATAC
CCCAAAAGTAAAATCAATTCATTTCATTAATTTAAAGTTTAAAACGATAAGAGTTTGTCTTTTTATGTTTACCATCTGCTGCAAGAATTTGACTACATCGATCCGTTCTCCAATTCTCTG
GCAATGCATCATCAAGTTTTCTTTTTTTTATTAAGAATATTTACACATTCTTTCATATTCCCTCTTCAACACTTGCTCTGATATTCAATGAAATTTTATGTTATCCTTACGTAATGATAG
AGATTTTGCCCAATAGTAGAAGAAATGTTTTGTAAAAGTAAACAAAAAATTATTACGAGTGCATGTTATATTAAATTCGGCCCTATCCACATCTAACTCAATCAGGATATATTAGTAATT
TAGTCATTATCGAACTGGTTAAATCACGTTATAATAGTATTTAAGTATGTTATATATATAATGATCAAAATTATTTTTTTCTGCTAATCATTACACTATTATATATAAATTTGGTCCAAA
TATAAAAATGTATATAAAGATTTTTATATTATCGTTTATCAACTAATTAAAACTTAATTAAGAAATATATAATTTTCAAAATAGTTATTAAAAAAATTGATGATTTTATCATATATGATA
AAGGAGAAAATTGATTTTGAACCCTCAAAATATTTTGAAATTTAGATTAATTTAATCCCATAAAGTCAATTCATTTCATTAATTTAAAGTTAAAATAGTATGATTTTTATGTTTGCACTA
TCATTTAATAATGTGGTACACGAATTTGACTACATCCGGTGGTTGTCCAATTCTGTAGCAACACATCATTAAGTTTTCTTTTTGTTAATATAATTACACACTCTTTCATTTTCTCTCTCT
TCAACACTTAGTTCTCTGCATGATATTAAATGAAAATTTTGTTATCCTTACGTAATGATAAGAGATTTTGCCCAATAGTAGAAGAAATGTTTTACAAAGTAAAAAAAGAAATTATATTGT
GAGCATTATTAAATTCGGCCAGATCAACATCTAACTCAACCAGGATATTATTATTAGTAATTAAGTCATTAATCAAACTGGTTAAACCACTATATATATAATGCTAAAAATACATTTTTT
CTGATGAGTGGCTGCTAAATATTAAACTATTATTTATAAAATTGGTTCAATCATAAAAACTAATTAAGATTTTTATATTATTAACTAATTAGAAATTCTGAAATAAAAACTAATTAGAAA
TTAAGAAACATATATGTTTCAAAATAATTACTATAAAACATATATTCAATGTGGACGTACAATACTTTAAATTTAAATTGAATGTCAAATATTTATATAGTTAACAAATAATAACACTTG
TGTTGGTGACTTTAAAACTATCTCAGCTTGGAGGTCCTTCATTCAACGTAGAGCTTGGACGCAAAGACGGGCTTATTTCCAAGGCATCAAGTGTAGAAGGAAACCTTCCGAAAGCAAACT
TCAATTTGGACCAACTCAACGCGCTTTTCTCAAAGCACGGCCTCAGCCAAACGGACATGATAGCGTTATCTGGGGCCCACACAGTGGGCTTCTCGCACTGTGACCAGTTCGCGAACCGTT
TATATTCCTTCTCGTCCTCCAACACGGTGGACCCCACTCTGGACCCCAGTTACGCCCAGGACCTAATGGCGGGGTGCCCTAGGAACCCCGACCCCACTGTAGCGGTTGCCCTGGACCCAC
AATCCCCTGCGGCCTTCGACAACTTGTATTACCAAAACCTGCTGTCGGGGAAAGGGTTGCTAACCTCAGACCAGGTTCTGTTCGAGGATGCCACGTCACAACCAACTGTTGTTAGGTTCG
CCAACAACGTTGCGGATTTTAACGATGCCTTTGTCGCAGCCATCAGGAAGCTTGCAAGGGTTGGGGTCAAGACTGGGAATGATGGAGAGATTCGGAGAGATTGCACCACATTCAATTCTT
GA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGAAAAGCATGAGGATGGTATTAATGGCTTTGTTGGCTTTCACGATGCTTTTATCTAAGGGTGAAGGCCAATTAGTAGAGAATTTCTACAGTTTATCTTGTCCAAACGTGGAATCC
ATCGTGAAACAAGCAGTGACTAACAAGTTTACACAGACCATTACAACTGGACAAGCAACTCTGCGTCTCTTTTTCCATGATTGCTTTGTTGAG
GGTTGTGATGCCTCAGTGATAATCTCG
TCGCCAAATGGGGACGCAGAGAAGGATGCAGAGGAGAATATTTCACTACCAGGAGATGGGTTTGACACTGTCATCAAGGCAAAGCAAGCAGTGGAATCTTCATGTCCTGGAGTGGTTTCA
TGTGCAGACATTTTGGCACTTGCTACCAGAGACGTTATAGGCTTG
CTTGGAGGTCCTTCATTCAACGTAGAGCTTGGACGCAAAGACGGGCTTATTTCCAAGGCATCAAGTGTAGAAGGA
AACCTTCCGAAAGCAAACTTCAATTTGGACCAACTCAACGCGCTTTTCTCAAAGCACGGCCTCAGCCAAACGGACATGATAGCGTTATCTGGGGCCCACACAGTGGGCTTCTCGCACTGT
GACCAGTTCGCGAACCGTTTATATTCCTTCTCGTCCTCCAACACGGTGGACCCCACTCTGGACCCCAGTTACGCCCAGGACCTAATGGCGGGGTGCCCTAGGAACCCCGACCCCACTGTA
GCGGTTGCCCTGGACCCACAATCCCCTGCGGCCTTCGACAACTTGTATTACCAAAACCTGCTGTCGGGGAAAGGGTTGCTAACCTCAGACCAGGTTCTGTTCGAGGATGCCACGTCACAA
CCAACTGTTGTTAGGTTCGCCAACAACGTTGCGGATTTTAACGATGCCTTTGTCGCAGCCATCAGGAAGCTTGCAAGGGTTGGGGTCAAGACTGGGAATGATGGAGAGATTCGGAGAGAT
TGCACCACATTCAATTCTTGA

Retrieve as FASTA