Entry information : GmPrx293 (Glyma17g20450.1)
Entry ID 9017
Creation 2011-07-04 (Qiang Li)
Last sequence changes 2016-01-04 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-01-04 (Achraf Jemmat)
Peroxidase information: GmPrx293 (Glyma17g20450.1)
Name (synonym) GmPrx293 (Glyma17g20450.1)
Class Class III peroxidase     [Orthogroup: Prx022]*
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmPrx293
start..stop
S start..stop
GmPrx203 454 5e-162 1..331 1..327
LjPrx36 444 3e-158 1..331 1..326
MtPrx58 436 8e-155 1..331 1..326
GmPrx103 433 7e-154 1..331 1..327
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 19474239..19474457 219 N° 2 19473674..19473865 192 N° 3 19473070..19473238 169 N° 4 19471782..19472197 416
complement(join(19471782..19472197,19473070..19473238,19473674..19473865,1947423 9..19474457))


exon

Literature and cross-references GmPrx293 (Glyma17g20450.1)
DNA ref. Phytozome 12:   Gm17 (19474457..19471782)
Protein sequence: GmPrx293 (Glyma17g20450.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   332 (305)
PWM (Da):   %s   36752.62 (33758.0) Transmb domain:   %s   i11-33o
PI (pH):   %s   6.03 (5.72) Peptide Signal:   %s   cut: 27 range:27-331
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MECTSNNKHSFVLLILLVLLSPLVLCQLRYDYYFATCPTLTFIVRNSLVLAMADEQRIAASILRLHFHDCFANGCDASVLLDDTSSFKGEKSALPNLNSLKGFELIDTIKSQIEWICPSTVSCADILALAAREAVNLSIGTYYWRPALLGRRDGTTASESEASWLPSPSDTLQNITNKFLSKGLDIKDLVVLSGAHTIGYARCFTLKQRFFNYKDTGKPDPSLDASLLQHLQKLCPDNSSDTNLAPLDPVTTYTFDNMYYKNLVKNLGLLPTDEALMSDSTTASLVNKYSQWPSGMVYFYKDFDVSLEKMGLIGVLTGPQGDIRKNCRVIN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGTGCACTTCCAATAATAAGCATTCTTTTGTTCTCTTGATTTTGCTCGTACTCCTTAGTCCTCTAGTACTTTGCCAACTTAGATATGACTACTATTTTGCAACATGTCCAACCCTC
ACTTTCATTGTTCGAAACTCACTTGTGCTAGCTATGGCAGATGAACAAAGGATTGCAGCTTCTATCTTACGCCTTCATTTCCATGATTGTTTTGCCAAT
GTAAATTAATAACCCCTCTCA
TTTTTTGTCATTGCTTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAGTTATTTTACTTATAAAAAAAATTATTCAT
TTTTTCTTCTTATATTTTCTGTCTTAAAAGTGATTCTTGAGAAAATTATCAAAACTGATCCTAACTAATTGCACTAGTTTCTGGTTTCTTTCTTTCTTTGAATTTTACCCAGGGATGTGA
TGCATCTGTGCTACTAGATGATACCAGCAGTTTTAAAGGGGAGAAAAGTGCATTGCCTAATCTAAATTCACTCAAAGGATTTGAGCTTATTGACACAATCAAGTCTCAAATAGAGTGGAT
ATGCCCATCCACCGTGTCATGTGCTGATATACTAGCTCTAGCAGCAAGAGAAGCTGTTAATCTT
GTAAGAAATTAACCCCTCTACCTTGTTATTAAGTGGTAACTAAGTTTTTAGTTAGT
AAATTCTTTTTGAAATTCAAATTTTATTCTCTAAATTCTTGTTTGACTGGTCAAGGTTTGAAAAACTTTTAGAATTTTTAGTTTTTAGTCTTTGAATAAAAGTTTGAGGTAATTATTTTT
ATTTATTTAATAAGATTTCAAAGATTAAAAATGTAAATTTTTAAAAGTTTAAAGACTAAAAATCCTAATGAAAAAAAGTTGAGAAATCTTGTTCAGTCAAACAAAAATTTAAATACTAAA
TATCAAATTTTTAAAAAATTTGGGGACTAAAAATCTTAATTAACCCTAATATTAATTAATCAACATTTTAAGGACTATATATAGTACATAAATACTGTTAATTAACCGAAGATATTTATA
ACTTCTGTAATTTTCTCAGAGTATAGGAACATATTACTGGCGACCAGCACTTCTTGGTCGTAGAGACGGCACAACAGCTAGTGAGAGCGAGGCTAGTTGGTTACCTTCACCCTCTGACAC
CTTACAAAACATTACCAACAAGTTCCTTTCAAAGGGTCTTGATATTAAGGATTTAGTAGTGCTCTCAG
GTTTGTTTGATTCCTTTTACTTATCAATTTTGATAATTTAGGAGTTCTCAAT
TTCTCAGGTAACTTTGATTTTACTACCCTTGAAGAGTAGGGAAATTATGTTTGCTAGGTACTTCGTAGCTTTAAGCTGTTATTGCTATTTGCTAGTCCTAAATATTGGTACTTTTGAGTT
TTGACTAATATTAACCACTTCATGTATTTCTATATTCCAACTCGGTTATAATAATTGTATAATAGCAAATAATAAATGTGACTGATCAATGTTAATAATAATTGAAGGACCCCTAGATTT
AAATGGAGACATGCATGGTACAACAGCTTTGTTGTAAGGGTGGGTTCATTTTTCTTCAGCAATAATGCAGTTGCTGTTAAATCATGGTACAATGATATATATAGTAAAGCAATAGATTGA
AACAGAGCTTTGTTCTCTCCTTCACACTCAAACTTGAATAGGAAAAGAGCAACAAAAAAATTGTTGAAAGTTAATAAGACATAGGGTTAAAATGTGTTTTAGATTCTTCAATTCTTCTTT
TTAAAATTAGTCTTAAATTTATATTTTAAAAATAATAATTTTGGTTATGATATTTTTTATAATCGGTGAATTTCATCCCTCTTTAAAGAACTTAGAATATTACAATAAGGGGCCAGATGC
ATCAATTATTACAAATAAAAAGATCAAAATCATTATTTTTAAAATAAAAGAACTAAAATTAATTTTATCCAAAAATTAATGGACTTTTTTTATACTAAAACAATTGATGTACTTAAAACA
CATTATATTGAAGTATATATCATGAGGCCTAAGTTGCTTTATACATGCTAGCCATCACATCAAGTGTACTAAACTCGTTATTTCTATGTGATCAACGCAGGAGCCCACACAATAGGCTAT
GCTCGGTGCTTTACATTGAAGCAAAGGTTTTTCAACTATAAGGACACTGGCAAACCGGATCCATCACTGGATGCTTCACTCTTACAACATTTACAGAAACTATGTCCAGATAACAGTTCT
GACACCAATTTGGCTCCCTTGGATCCTGTCACCACATACACATTTGATAACATGTATTACAAAAACCTTGTTAAGAACTTAGGGTTACTACCAACTGATGAGGCTCTTATGAGTGATAGC
ACAACTGCTTCGTTGGTGAACAAGTATAGCCAGTGGCCAAGTGGTATGGTTTACTTTTACAAGGACTTTGATGTGTCTCTAGAGAAAATGGGCCTTATAGGTGTACTTACAGGACCACAA
GGGGACATAAGGAAAAACTGCAGGGTGATCAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGTGCACTTCCAATAATAAGCATTCTTTTGTTCTCTTGATTTTGCTCGTACTCCTTAGTCCTCTAGTACTTTGCCAACTTAGATATGACTACTATTTTGCAACATGTCCAACCCTC
ACTTTCATTGTTCGAAACTCACTTGTGCTAGCTATGGCAGATGAACAAAGGATTGCAGCTTCTATCTTACGCCTTCATTTCCATGATTGTTTTGCCAAT
GGATGTGATGCATCTGTGCTA
CTAGATGATACCAGCAGTTTTAAAGGGGAGAAAAGTGCATTGCCTAATCTAAATTCACTCAAAGGATTTGAGCTTATTGACACAATCAAGTCTCAAATAGAGTGGATATGCCCATCCACC
GTGTCATGTGCTGATATACTAGCTCTAGCAGCAAGAGAAGCTGTTAATCTT
AGTATAGGAACATATTACTGGCGACCAGCACTTCTTGGTCGTAGAGACGGCACAACAGCTAGTGAGAGC
GAGGCTAGTTGGTTACCTTCACCCTCTGACACCTTACAAAACATTACCAACAAGTTCCTTTCAAAGGGTCTTGATATTAAGGATTTAGTAGTGCTCTCAG
GAGCCCACACAATAGGCTAT
GCTCGGTGCTTTACATTGAAGCAAAGGTTTTTCAACTATAAGGACACTGGCAAACCGGATCCATCACTGGATGCTTCACTCTTACAACATTTACAGAAACTATGTCCAGATAACAGTTCT
GACACCAATTTGGCTCCCTTGGATCCTGTCACCACATACACATTTGATAACATGTATTACAAAAACCTTGTTAAGAACTTAGGGTTACTACCAACTGATGAGGCTCTTATGAGTGATAGC
ACAACTGCTTCGTTGGTGAACAAGTATAGCCAGTGGCCAAGTGGTATGGTTTACTTTTACAAGGACTTTGATGTGTCTCTAGAGAAAATGGGCCTTATAGGTGTACTTACAGGACCACAA
GGGGACATAAGGAAAAACTGCAGGGTGATCAACTAG

Retrieve as FASTA