Entry information : GmPrx308 (Glyma19g16960.1)
Entry ID 9023
Creation 2011-07-04 (Qiang Li)
Last sequence changes 2011-11-28 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-12-09 (Christophe Dunand)
Peroxidase information: GmPrx308 (Glyma19g16960.1)
Name (synonym) GmPrx308 (Glyma19g16960.1)
Class Class III peroxidase    [Orthogroup: Prx019]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmPrx308
start..stop
S start..stop
CroPrx72 400 6e-141 1..317 7..323
CpapPrx12 400 3e-139 21..317 10..308
MtPrx89 393 3e-138 14..317 13..312
EcamPrx48 391 1e-137 19..319 21..321
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 20664872..20665069 198 N° 2 20663605..20664369 765  
complement(join(20663605..20664369,20664872..20665069))


exon

Literature and cross-references GmPrx308 (Glyma19g16960.1)
DNA ref. Phytozome 12:   Gm19 (20665069..20663605)
Protein sequence: GmPrx308 (Glyma19g16960.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   321 (301)
PWM (Da):   %s   35203.06 (32874.7) Transmb domain:   %s   o4-26i
PI (pH):   %s   5.7 (5.39) Peptide Signal:   %s   cut: 20 range:20-320
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKLTTILIFFIFALPFTFANLRVGFYTATCPRAETIVGEVVQRRFSQDKSIVAALLRMHFHDCFVRGCDASILIDPTSTRTSEKIAGPNQTVRGFEIIDEAKAILEQACPLTVSCADIIALATRDAVALAGGIRYSIPTGRKDGLLADPSLVILPAPSLSVQGALQFFTARGLTLEDMVTLLGGHTVGFAHCSVFQERLSSVQGRVDPTMDPELDAKLVQICESNRPSLSDPRVFLDQNSSFLFDNQFYNQMRLRRGVLHLDQQLAFDSLSRDIVEDFAANDGTFQERFANAMIKLGSIGVLDGNEGDVRRNCRAFNIPL*

Retrieve as FASTA  
Remarks Complete sequence from genomic (intron 1).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGCTCACTACCATCTTAATCTTCTTCATCTTTGCCCTTCCGTTCACATTTGCTAACCTGCGCGTTGGATTCTATACCGCAACATGTCCAAGAGCAGAGACAATTGTAGGTGAAGTT
GTGCAAAGGCGTTTCAGCCAGGATAAATCCATTGTCGCAGCCCTTCTTCGCATGCACTTTCACGATTGCTTTGTTAGA
GTAAGACCAAAACTATATATACTCGTTGAAAAACGTGTTAAT
TAGTTCGTATTTACACACTCATTTTCTTTCAATATATAGATGAGGTTATTTAAGTTAATTAATTTCTATCTGATTAATGCTATCTATGCCATGTTGTTACGTACGGTTTTAAATTGTAGT
TACAGCTTAATTTATTGTCATCATTAATAGTATTAAAAAAATTATGATGTTGTGGTCACAAATAACTTTTTAAAACCATAAAAGTGGATAAATTGTGACTTTGTTAATACGTAGGAACTA
AATACCCGTGTGAGGGAGTTTACAACACGCCCACACCCTATTTAATAAATTAAACTGGTGACTGATAATTTAAGTTAATTATGATGTTTTAAGTTAATTTCTTTTAAAAAATTATGTATA
AATGTGACTGATAATGCCACAATTACCATGTTTCATGCAGATCGATTGTCGAAATTATGATGTTATATATAATTAATATTTTTTAGCATTTTGGTTTCAGGGTTGTGATGCCTCAATACT
AATAGATCCAACAAGCACTAGAACATCAGAGAAGATTGCAGGGCCAAACCAAACTGTTCGTGGATTTGAGATCATTGATGAAGCAAAAGCAATCTTAGAACAAGCGTGCCCTTTAACTGT
TTCATGCGCAGATATCATAGCACTTGCCACAAGAGATGCAGTGGCACTGGCAGGAGGGATAAGGTACAGCATCCCCACGGGAAGAAAAGATGGTCTATTAGCCGATCCTTCCTTAGTAAT
CCTTCCAGCACCATCATTGTCTGTACAAGGTGCTCTTCAGTTTTTCACCGCAAGAGGGTTGACACTAGAGGACATGGTGACCCTTTTGGGAGGACACACCGTTGGTTTTGCTCACTGTAG
TGTGTTTCAAGAGAGGCTTTCAAGTGTTCAAGGAAGAGTTGATCCTACAATGGATCCTGAATTGGATGCAAAGCTGGTGCAAATTTGTGAGTCCAATAGGCCATCATTGAGTGACCCTCG
TGTGTTTTTGGATCAAAACTCTTCTTTTTTATTTGACAATCAATTTTACAACCAAATGAGGCTTAGGAGAGGGGTACTTCACCTTGATCAGCAATTGGCTTTCGACTCATTGTCAAGGGA
CATTGTGGAGGATTTTGCGGCAAATGATGGTACATTTCAAGAGAGATTTGCAAATGCCATGATAAAGTTGGGGAGCATTGGTGTTTTGGATGGAAACGAAGGTGATGTAAGAAGGAATTG
CAGGGCTTTTAATATTCCTCTGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGCTCACTACCATCTTAATCTTCTTCATCTTTGCCCTTCCGTTCACATTTGCTAACCTGCGCGTTGGATTCTATACCGCAACATGTCCAAGAGCAGAGACAATTGTAGGTGAAGTT
GTGCAAAGGCGTTTCAGCCAGGATAAATCCATTGTCGCAGCCCTTCTTCGCATGCACTTTCACGATTGCTTTGTTAGA
GGTTGTGATGCCTCAATACTAATAGATCCAACAAGCACTAGA
ACATCAGAGAAGATTGCAGGGCCAAACCAAACTGTTCGTGGATTTGAGATCATTGATGAAGCAAAAGCAATCTTAGAACAAGCGTGCCCTTTAACTGTTTCATGCGCAGATATCATAGCA
CTTGCCACAAGAGATGCAGTGGCACTGGCAGGAGGGATAAGGTACAGCATCCCCACGGGAAGAAAAGATGGTCTATTAGCCGATCCTTCCTTAGTAATCCTTCCAGCACCATCATTGTCT
GTACAAGGTGCTCTTCAGTTTTTCACCGCAAGAGGGTTGACACTAGAGGACATGGTGACCCTTTTGGGAGGACACACCGTTGGTTTTGCTCACTGTAGTGTGTTTCAAGAGAGGCTTTCA
AGTGTTCAAGGAAGAGTTGATCCTACAATGGATCCTGAATTGGATGCAAAGCTGGTGCAAATTTGTGAGTCCAATAGGCCATCATTGAGTGACCCTCGTGTGTTTTTGGATCAAAACTCT
TCTTTTTTATTTGACAATCAATTTTACAACCAAATGAGGCTTAGGAGAGGGGTACTTCACCTTGATCAGCAATTGGCTTTCGACTCATTGTCAAGGGACATTGTGGAGGATTTTGCGGCA
AATGATGGTACATTTCAAGAGAGATTTGCAAATGCCATGATAAAGTTGGGGAGCATTGGTGTTTTGGATGGAAACGAAGGTGATGTAAGAAGGAATTGCAGGGCTTTTAATATTCCTCTG
TAG

Retrieve as FASTA