Entry information : SbPrx139 (Sobic.010G232500.1 [2.1] / Sb10g027490 [1.4])
Entry ID 903
Creation 2007-09-10 (Christophe Dunand)
Last sequence changes 2007-09-10 (Christophe Dunand)
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-08-04 (Messaoudi)
Peroxidase information: SbPrx139 (Sobic.010G232500.1 [2.1] / Sb10g027490 [1.4])
Name (synonym) SbPrx139 (Sobic.010G232500.1 [2.1] / Sb10g027490 [1.4])
Class Class III peroxidase    [Orthogroup: Prx009]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation N/D
Tissue types Ovaries
Seedlings
Inducer Dark growth
Repressor N/D
Best BLASTp hits
Perox score E-value SbPrx139
start..stop
S start..stop
SofPrx01 625 0 1..331 1..331
ZmPrx20 598 0 24..331 21..328
SiPrx29 576 0 19..331 17..330
OsPrx89 506 0 27..329 28..331
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 57294775..57294990 216 N° 2 57295123..57295314 192 N° 3 57295457..57295619 163 N° 4 57297352..57297776 425
join(57294775..57294990,57295123..57295314,57295457..57295619,57297352..57297776 )


exon

Literature and cross-references SbPrx139 (Sobic.010G232500.1 [2.1] / Sb10g027490 [1.4])
Literature Cordonnier-Pratt,M.-M. et al., unpublished
DNA ref. Phytozome 12:   chromosome_10 (57294775..57297776)
Protein sequence: SbPrx139 (Sobic.010G232500.1 [2.1] / Sb10g027490 [1.4])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   331 (306)
PWM (Da):   %s   35653.49 (33178.0) Transmb domain:   %s   i5-27o
PI (pH):   %s   8.57 (8.01) Peptide Signal:   %s   cut: 26 range:26-331
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVRRMVLVAALVVATVAVLAGGARAQLKEGFYGSTCPQAEKIVKEFVKAHIPHAPDVAATLIRTHFHDCFVRGCDASVLLNATGGKEAEKDAAPNQTLRGFGFIDRIKALLEKECPGVVSCADILALAARDSVGVIGGPFWSVPTGRRDGTVSIKQEALDQIPAPTMNFTTLLQSFRNKSLDLADLVWLSGAHTIGISHCNSFSERLYNFTGRAVPGDADPSLDPLYAAKLRRKCKTLTDNTTIVEMDPGSFRTFDLSYYRGVLKRRGLFQSDAALITDAASKADILSVVNAPPEVFFQVFARSMVKMGAIDVKTGSEGEIRKHCAFVNKH

Retrieve as FASTA  
Remarks Complete sequence from 2 ESTs and genomic (chromo 10, 3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTGAGAAGAATGGTGCTGGTGGCGGCGCTGGTGGTGGCCACCGTCGCCGTCCTCGCCGGCGGCGCGCGGGCGCAGCTCAAGGAAGGGTTCTACGGCTCCACCTGCCCGCAGGCGGAG
AAGATCGTCAAGGAGTTCGTCAAGGCGCACATCCCGCACGCGCCTGACGTCGCCGCCACCCTGATCCGCACCCACTTCCACGACTGCTTCGTCAGG
GTACGTACACTTCAGCTAGCTAGC
ATGCCAGCGTCCTGCCTGCCTGCTGCCTGCGCGCCGACGAATGCCGATGCCGACGATGACCGACTCTGCGCCATGGCATGCTGTAATGCTTCCCCTGCTGCTATGCAGGGCTGCGACGCG
TCGGTGCTGCTCAACGCGACGGGCGGCAAGGAGGCGGAGAAGGACGCGGCGCCCAACCAGACGCTGCGGGGCTTCGGCTTCATCGACCGCATCAAGGCGCTGCTCGAGAAGGAGTGCCCC
GGCGTCGTGTCCTGCGCCGACATCCTCGCGCTCGCCGCCCGCGACTCCGTCGGCGTCATC
GTAAGCCTTCCTCATCGAGCGAGCGTGTCCCCATGCATCATATCCTGAATTAATGCATCA
GCCGCCGGCCGGCCGGTGACTGTCGATCACTGACTCTTCTCCTCTCTCTCTCCGCCGTGCGCGTATGATATGATGCATGCAGGGCGGGCCGTTCTGGAGCGTGCCGACGGGGAGGCGCGA
CGGCACCGTGTCCATCAAGCAGGAGGCGCTGGACCAGATCCCCGCGCCCACCATGAACTTCACCACACTCCTCCAGTCCTTCCGCAACAAGAGCCTCGACCTCGCCGACCTCGTCTGGCT
CTCAG
GTACGCTACTCCCTCCATTGCCGCCACCCACCATTCTCAGCTCAGCTACTACACTGCGGCTTTATTTGTTATTTCACCTCACGACAACTTCACTGGCATCATTTAACAAATTGCT
TAAATAAAAGGAGAAACAAACAAGAAGTTTATCTTCCACCTGTCAATCAATCAACTTAATTTACCCAGTCAGACAACTGACATGCCAAGGAACTAGACAGATTAGCAGTGACAGGTCTGA
CTAGTCCTCAGATTACATTACAGGGCACACTTGCAAGTTTATCTGCTTATTAAACGTGCTGCTTCCAACCAACAGCACCGACACCGAGTGATCAATGTTACATACGCTTTCGTTGGACGC
TGGGTGAATCATTTGTTTGGAGAGTCCTCCTATCTGAATAGTATGTTCGGTCAGGCCCGCATAGGCACTAGGCAGTAGGACTAGGAGTGCTCTGATTGTACTAGTAGATGACTAGTAGCC
TTGGCAAATTGCTTATGACACGCTCCTACTCTAGCTACTTACTCTATGTAGGACCAGTAAGCACTGATGTCCTCCCAAACTAGATAGCTCCAAGATAAAAAATTACAGATGATGTACAAT
TAGTTATGAGTAAACTGAACAAACACTAAGAGCCTAGAACGTTTCGGGAGCAATTAGTTCGATGCCATGGCCGGATTGGACGGAGAACCTGAACATGCATGGTCAAATCTGAAATCTTCA
TCTAAAAGGCGAAAGTTCAGCACCTAACAGTATTTTAGTGACGTACTACACGCATGCACAAAACAATGTTAGGAAGCTTAAATTTGTGTTTCTAGAGTGAATCCGTAGCCACCAGAAAAA
GAGGCTTTTTAAACTGGGCAGCTGCAATTCTGTTCATATTAGTGTCAAGCACAGCTGAGTAGAGTGTAGCTGACAGCTGCACGTCATCCTTGAGGATCGGAGGGACACAGCATGTTAGTA
CTAGTTAGCATCTAAAGGATGGTTTTGTCCTGCCTATGTATGTAGCTGGAGTTTGGTAGCCGGAAAATGATTAAGTACGACAGAGATAAGATAAATTTGCCTAAAAACTAGTTATGATAA
CTGACAGAGATTGTAGCTAGGTGACCCCCTGCATTGCATCCAACAAGGCAGAGGCAGGTTTAACTTACAGCGTTCTTCAGAGCAGGTCATCTTGCTTGCTTAAAGTAAAAGAAGAGATTT
GATGGCATGTGGAGAAGGTGAACTTGGAATCTGAAGATCAGAACATGTGTATACTCCTCATCATTTGAGGAGGACATCCCGGGTCACTGACCAGACTGGTTTTGACCACTGATGTGCTTC
CATTTTTCGTATGTGCATGTCTGCATGACATTAATCGGCAACCTCTTCTGATGTAGACATGCACGCTGCTGCCAACTACCTTCCACCGGTCTATTCCAATCTATAGTATCATAGATAGAA
GATGAGCCTTTAGTATATACTCCTATATGCAAACACCAGACAGAGGATACTTCTGAAATGGTCCTTTTCCTAGAACAGACGCTTCTGATGGAGTAGGTTGATGTTGCCTTCAAATACATA
CCTCATATTTATAACCTGCCGATCGACAAATATAAGGATATAATTGCAAAGTACTCCGTATTTCAGAGAAGAGAACACTGATAATTTCCTGAATATATAGCTCCGAAAACTATAGATACA
CTGAATAGTTGGCATTTCACCCAGACATTAATTCCTAATCACATTTTGCGTGTGCAGGGGCTCACACGATCGGCATCTCCCACTGCAACTCCTTCAGCGAGCGGCTGTACAACTTCACGG
GGCGCGCCGTTCCCGGGGACGCGGACCCGTCGCTGGACCCGCTGTACGCGGCGAAGCTGCGGCGGAAGTGCAAGACGCTGACGGACAACACGACGATCGTGGAGATGGACCCGGGGAGCT
TCCGCACCTTCGACCTCAGCTACTACCGCGGCGTGCTCAAGCGGCGGGGCCTGTTCCAGTCCGACGCCGCGCTCATCACCGACGCCGCCTCCAAGGCCGACATCCTCAGCGTGGTGAACG
CGCCGCCCGAGGTGTTCTTCCAGGTCTTCGCGCGCTCCATGGTGAAGATGGGCGCCATCGACGTCAAGACCGGCTCCGAGGGCGAGATCAGGAAGCACTGCGCCTTCGTCAACAAGCACT
AG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTGAGAAGAATGGTGCTGGTGGCGGCGCTGGTGGTGGCCACCGTCGCCGTCCTCGCCGGCGGCGCGCGGGCGCAGCTCAAGGAAGGGTTCTACGGCTCCACCTGCCCGCAGGCGGAG
AAGATCGTCAAGGAGTTCGTCAAGGCGCACATCCCGCACGCGCCTGACGTCGCCGCCACCCTGATCCGCACCCACTTCCACGACTGCTTCGTCAGG
GGCTGCGACGCGTCGGTGCTGCTC
AACGCGACGGGCGGCAAGGAGGCGGAGAAGGACGCGGCGCCCAACCAGACGCTGCGGGGCTTCGGCTTCATCGACCGCATCAAGGCGCTGCTCGAGAAGGAGTGCCCCGGCGTCGTGTCC
TGCGCCGACATCCTCGCGCTCGCCGCCCGCGACTCCGTCGGCGTCATC
GGCGGGCCGTTCTGGAGCGTGCCGACGGGGAGGCGCGACGGCACCGTGTCCATCAAGCAGGAGGCGCTGGAC
CAGATCCCCGCGCCCACCATGAACTTCACCACACTCCTCCAGTCCTTCCGCAACAAGAGCCTCGACCTCGCCGACCTCGTCTGGCTCTCAG
GGGCTCACACGATCGGCATCTCCCACTGC
AACTCCTTCAGCGAGCGGCTGTACAACTTCACGGGGCGCGCCGTTCCCGGGGACGCGGACCCGTCGCTGGACCCGCTGTACGCGGCGAAGCTGCGGCGGAAGTGCAAGACGCTGACGGAC
AACACGACGATCGTGGAGATGGACCCGGGGAGCTTCCGCACCTTCGACCTCAGCTACTACCGCGGCGTGCTCAAGCGGCGGGGCCTGTTCCAGTCCGACGCCGCGCTCATCACCGACGCC
GCCTCCAAGGCCGACATCCTCAGCGTGGTGAACGCGCCGCCCGAGGTGTTCTTCCAGGTCTTCGCGCGCTCCATGGTGAAGATGGGCGCCATCGACGTCAAGACCGGCTCCGAGGGCGAG
ATCAGGAAGCACTGCGCCTTCGTCAACAAGCACTAG

Retrieve as FASTA