Entry information : GmPrx[P]313 (Glyma20g04430.1)
Entry ID 9049
Creation 2011-07-04 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status theoretical translation / pseudogene
Reviewer Christophe Dunand
Last annotation changes 2011-12-13 (Qiang Li)
Peroxidase information: GmPrx[P]313 (Glyma20g04430.1)
Name (synonym) GmPrx[P]313 (Glyma20g04430.1)
Class Class III peroxidase     [Orthogroup: Prx041]*
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Glycine
Organism Glycine max (soybean)    [TaxId: 3847 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GmPrx[P]313
start..stop
S start..stop
GmPrx105 467 8e-169 1..240 85..332
MtPrx90 415 4e-148 1..239 85..331
PpePrx23 359 5e-126 1..240 85..333
GmPrx[P]246 348 1e-123 1..235 9..226
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 4590613..4590765 153 N° 2 4590848..4591013 166 N° 3 4591339..4591742 404  
join(4590613..4590765,4590848..4591013,4591339..4591742)


exon

Literature and cross-references GmPrx[P]313 (Glyma20g04430.1)
DNA ref. Phytozome 12:   Gm20 (4590613..4591742)
Protein sequence: GmPrx[P]313 (Glyma20g04430.1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   240
PWM (Da):   %s   27099.89  
PI (pH):   %s   7.46
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTSEKLAGPNLNSLCGFEVIDKIKYLVKEECPITVSCVDILAMAARDVVELRGGPRWDALLGRKDALESSFSGANILIPAPNSSLEVLIDNFKQQGLDIEDLVTLSGSHTIGRARCLSFRQRIYNAKEEYHYGYDHYKRYTSFRRILRSICPVEGRDTKFAPLDFQTPKRFHNHYFINILEGKGLLGSDNVLISHDLDGKTTEQVWAYASNEKLLIKMGNINVLTGNEGEIRRNCRFVDA*

Retrieve as FASTA  
Remarks Pseudogene from genomic. Incorrect prediction from phytozome (first exon is missing and not found). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACAAGTGAAAAGCTGGCTGGACCAAATCTGAACTCTTTATGTGGATTTGAGGTCATAGATAAGATAAAGTATTTGGTTAAAGAAGAATGTCCTATTACTGTTTCATGTGTTGACATC
CTTGCCATGGCTGCACGTGATGTTGTTGAATTG
GTAAACACTAGGGGTCAAATGAATNNNNNNNNNNNNNNNNNNNNNNNNNNTTTACAAAAATTTTTATCATTCGTTTTTGAAGAGAGG
AGGACCAAGATGGGATGCCTTGCTTGGAAGGAAGGATGCTCTCGAGTCAAGTTTTAGTGGAGCTAACATATTAATTCCTGCTCCAAATTCATCTTTGGAGGTTCTCATAGATAATTTTAA
GCAACAAGGCCTCGACATAGAAGACTTGGTAACTCTATCTG
GTATATTTATTATTTTGACAAGATATATATACAACTTTCTAAATTGCTGTTAGTACAATTTTCTAATCAAAATTAGTGT
TCCACATCTTTATAAAAAAAATTAGTGGCCCGCCTTAATGAATTATTGAAATAAAACTAATTTTTAATTGAAAAATAACACAAACAAAACCCCAATTCTAATTGATGAATAACACAAACA
ATACCTATAAAAACTCTAATTTTGTCCTTATAATTTGTTCAAAGTTCAATCAAATGTTAATATTTTGGGACTCTGACAAAGGAAGAAGAGATTAAGCATGTAGAGTTCCTGCTTGACAAA
ATACAGGTAGCCATACTATAGGAAGAGCAAGATGTCTAAGCTTCAGGCAGAGGATATATAATGCAAAAGAGGAATATCATTATGGCTATGATCACTACAAACGATACACAAGTTTCAGGA
GAATCCTGCGGTCCATATGCCCTGTTGAGGGAAGGGACACTAAATTTGCACCCTTGGATTTTCAAACCCCAAAAAGATTTCACAATCACTACTTCATAAACATTCTTGAAGGGAAAGGCT
TGTTAGGTTCTGACAATGTTCTTATCAGCCATGACTTAGATGGAAAGACTACAGAGCAGGTGTGGGCTTATGCCTCTAATGAAAAACTTTTGATTAAGATGGGAAACATCAATGTTCTTA
CAGGAAATGAGGGGGAAATTAGGAGGAATTGTAGGTTTGTTGATGCTTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACAAGTGAAAAGCTGGCTGGACCAAATCTGAACTCTTTATGTGGATTTGAGGTCATAGATAAGATAAAGTATTTGGTTAAAGAAGAATGTCCTATTACTGTTTCATGTGTTGACATC
CTTGCCATGGCTGCACGTGATGTTGTTGAATTG
AGAGGAGGACCAAGATGGGATGCCTTGCTTGGAAGGAAGGATGCTCTCGAGTCAAGTTTTAGTGGAGCTAACATATTAATTCCTGCT
CCAAATTCATCTTTGGAGGTTCTCATAGATAATTTTAAGCAACAAGGCCTCGACATAGAAGACTTGGTAACTCTATCTG
GTAGCCATACTATAGGAAGAGCAAGATGTCTAAGCTTCAGG
CAGAGGATATATAATGCAAAAGAGGAATATCATTATGGCTATGATCACTACAAACGATACACAAGTTTCAGGAGAATCCTGCGGTCCATATGCCCTGTTGAGGGAAGGGACACTAAATTT
GCACCCTTGGATTTTCAAACCCCAAAAAGATTTCACAATCACTACTTCATAAACATTCTTGAAGGGAAAGGCTTGTTAGGTTCTGACAATGTTCTTATCAGCCATGACTTAGATGGAAAG
ACTACAGAGCAGGTGTGGGCTTATGCCTCTAATGAAAAACTTTTGATTAAGATGGGAAACATCAATGTTCTTACAGGAAATGAGGGGGAAATTAGGAGGAATTGTAGGTTTGTTGATGCT
TAG

Retrieve as FASTA