Entry information : MeAPx02 (cassava4.1_027646m)
Entry ID 9051
Creation 2011-07-01 (Qiang Li)
Last sequence changes 2016-01-06 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-01-06 (Achraf Jemmat)
Peroxidase information: MeAPx02 (cassava4.1_027646m)
Name (synonym) MeAPx02 (cassava4.1_027646m)
Class Ascorbate peroxidase    [Orthogroup: APx004]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Manihot
Organism Manihot esculenta (cassava)    [TaxId: 3983 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MeAPx02
start..stop
S start..stop
PtAPx10 585 0 1..349 1..347
VvAPx07 577 0 1..349 1..344
CpapAPx06 567 0 1..349 4..347
CclAPx01 560 0 1..349 1..349
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 5558116..5558214 99 N° 2 5558328..5558429 102 N° 3 5558576..5558660 85 N° 4 5558748..5558782 35
N° 5 5558879..5558944 66 N° 6 5559049..5559089 41 N° 7 5559433..5559563 131 N° 8 5559708..5559814 107
N° 9 5560157..5560294 138 N° 10 5560423..5560557 135 N° 11 5560649..5560759 111  
join(5558116..5558214,5558328..5558429,5558576..5558660,5558748..5558782,5558879 ..5558944,5559049..5559089,5559433..5559563,5559708..5559814,5560157..5560294,55 60423..5560557,5560649..5560759)


exon

Literature and cross-references MeAPx02 (cassava4.1_027646m)
DNA ref. Phytozome 11:   scaffold08574 (4274..2952)
Protein sequence: MeAPx02 (cassava4.1_027646m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   350
PWM (Da):   %s   38227.55  
PI (pH):   %s   7.91
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGVSFLSTFPSLLHLSSLSNPNAGTHRYPSSRAGPIRCNKIETDVTGGENVFRRRDVLKCFGAAISLELITSSGSFTEMANAADLIQRRQRSEFQSSVKQTIFTAIGKPEVIPSILTLALNDAMTFDKATKSGGPNGSVRFSSEISRPENKGLSAALDLLEEAKKEIDSYSKGGPISYADLIQFAQSALKSTFLASAIRKCGGNEEKGTLLYTAYGSNGQWGLFDKQFGRTDTQEPDPEGRIPQWEKATVQEMKDKFKAVGFGPRLAVMSAFLGPDQAATEALLATDPEVLPWVQKYQRSRETVSETDYEVDLITTLTKLSCLGQQINYEAYTYPVQKIDVTKLKL*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGGGTCTCTTTCCTCTCAACTTTCCCTTCTCTGCTTCATCTCTCTTCTCTGAGCAATCCCAATGCTGGCACTCACAGATACCCTTCCTCTCGTGCTGTAGGTTCACTTCACTCACCT
CTTCGTTTTCCTTTATATAGACAATTGTAGTTTGTGTATAGCATTGTAAGCAAAAACCACCCTTTGTTTTTGTTTCTGCACTTAACAAATAGGGTCCCATCCGTTGCAACAAAATTGAGA
CCGATGTTACTGGTGGCGAGAATGTTTTCCGGCGAAGAGACGTTTTGAAATGCTTTGGAGCTGCGATTAGCTTG
GTAAGAGAAAATCTGAAGAGGTCATTGAATGCATACTTTTCATTGC
CCATGTGAGGGAACATTTGAATTAGGCATTTCGAGATTTGATAGTCTGTGATTTAGAATGATGTGATGATGAGTTTCTACCAGTTTTGATGTCATCTTAGGAATTAATAACGAGCTCAGG
ATCATTCACTGAAATGGCTAATGCTGCTGATTTGATCCAACGCAGACAGCGCTCTGAGTTTCAGT
GTAAGTCTTCTTAAACTCTGTAGAACAAATTTTCCTTATCTAGAACCAGCTACAG
TCTGCTGAATTAGAGCTGCTTTTTTCTCACAGCAAGTGTTAAGCAGACTATTTTTACAGCTATAAAGGTAAGTTCTGATGCATTAAGCTTTAAAATTCTGATATATACTATCCTGCAATG
ATTTCTTCTGTTGTGATCATTCCTAAATCTATATTCATTGCAGGGAAAGCCTGAAGTTATTCCATCAATTCTCACCCTGGCACTGAATGATGCCATGACTTTTGATAAGGTCAGACCACA
AACCTTACCTGTGAACAATTTCTTTCTGGATGTTACGGAACTCCTTTGAAAAGGGAAACAAATAAACTGATCTCTTTCTGATTAAGTTTGTAGGCTACAAAATCTGGAGGCCCAAATGGA
TCTGTACGGTTCAG
GTATCCACTATATGCAATATGCATGAATCTCATATCCAAGTAACATCTGGTCCATGCTAACTTGCTGTCAATATATCCTCAAGTATAACATCTATGAACATTAACT
TATAAAATGCTTCAGAAAGAAGTCTGTTGGGTAAATGGCGATATGGGACGTTAAGTCTTGCTGGTTTTATAGCTTTTTGAAACTCATTAGCAACAAGCTTATATTGTTTTAGTTATCAGC
TATAAAGAACTAATAATTTTTTCTTGGTTTTTCGATTGTATTTGCAATTTGAAGAACTATTTTTCCCCTTGCTGAACTGCTATCTTAACATATTTTCCCCATTTTTGCTGCCTGAAGCTC
AGAGATAAGCAGACCTGAAAACAAGGGACTCTCCGCTGCTCTTGATTTATTAGAAGAAGCAAAGAAAGAGATAGATTCATATTCCAAGGGCGGACCAATCTCCTATGCAGATCTTATACA
ATTCGCAG
GTTATGCATATTTAAAACCTAGTTTGAACCATACTGCATATAATGGCTATATCTTGAATGAGCTAAAATATGCAGACAAATAGAATATGATTCATCAACAGGAAAGTGCATT
GCCGCTGACTCAGTGTTCTTCGTTCTGTGTAGCACAAAGTGCACTTAAGTCCACATTTCTAGCTTCTGCCATTAGAAAGTGTGGTGGTAATGAAGAGAAAGGGACCTTATTATACACTGC
TTATGGTTCTAATGGGCAG
GTTAGTCTTTCTAGTTTGGTTGCCTTGAAATGCATTTAACTGATAGGCACCTAGATATATGACAGATTTGAGCAATTATCCCATTCATTATAGCTGCTTAT
TGAAGTCGTAACCTGAAACAATACACGTTTTTTTAAAAGAAATGTTGAATTATGTCTCGTATTTGTTGTTGGAAAAGAATTTCTGGACTAGACAGAGCTTTGATTCCTTTTCAATTGTGA
AAAGGCATTCGACTACTTCCGTGCGTGTGTTCATTGTGTAATTAATATGATAACAGAGAATTTCTAAAAATGTAAATGATATAGCGAAACGATGTAATGCATGTAAATATTGTTGAAACA
GTGGGGCTTGTTTGATAAACAATTTGGACGGACGGATACACAAGAGCCAGATCCAGAAGGACGGATTCCGCAGTGGGAGAAAGCAACTGTCCAGGAAATGAAAGACAAGTTCAAAGCTGT
TGGCTTCGGTCCTCGCCAG
GTATCTAACTTCTTTTCTTCTTCACCTGCCACTTGCTTATACAGGTTTTTGTGCGTTGATAAAATTCTAAGTAGAATTTAGCATATTATAGTTTACTAATC
TGTTTCTATCCTTTTCTGGTTGGCCAGCTAGCAGTTATGTCTGCATTCTTAGGTCCTGATCAAGCAGCTACTGAGGCCTTACTTGCTACTGATCCAGAAGTTTTACCATGGGTTCAGAAG
TACCAACGCAGCCGAGAAACAGTGTCCGAAACAGATTATGAG
GTCAGTGTTTCAACTAAACTGAAACCTTTATCATATCTGTATATTGCATTTTTGTATTCTTATTGTAGTTTGGGAATT
TGTTGTTCTTCAGGTGGATCTGATAACCACTCTCACCAAATTAAGTTGCTTGGGCCAACAAATCAATTATGAAGCTTACACATACCCTGTCCAAAAAATTGATGTGACCAAACTCAAATT
ATAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGGGTCTCTTTCCTCTCAACTTTCCCTTCTCTGCTTCATCTCTCTTCTCTGAGCAATCCCAATGCTGGCACTCACAGATACCCTTCCTCTCGTGCTGGTCCCATCCGTTGCAACAAA
ATTGAGACCGATGTTACTGGTGGCGAGAATGTTTTCCGGCGAAGAGACGTTTTGAAATGCTTTGGAGCTGCGATTAGCTTG
GAATTAATAACGAGCTCAGGATCATTCACTGAAATGGCT
AATGCTGCTGATTTGATCCAACGCAGACAGCGCTCTGAGTTTCAGT
CAAGTGTTAAGCAGACTATTTTTACAGCTATAAAGGGAAAGCCTGAAGTTATTCCATCAATTCTCACCCTGGCA
CTGAATGATGCCATGACTTTTGATAAG
GCTACAAAATCTGGAGGCCCAAATGGATCTGTACGGTTCAGCTCAGAGATAAGCAGACCTGAAAACAAGGGACTCTCCGCTGCTCTTGATTTA
TTAGAAGAAGCAAAGAAAGAGATAGATTCATATTCCAAGGGCGGACCAATCTCCTATGCAGATCTTATACAATTCGCAG
CACAAAGTGCACTTAAGTCCACATTTCTAGCTTCTGCCATT
AGAAAGTGTGGTGGTAATGAAGAGAAAGGGACCTTATTATACACTGCTTATGGTTCTAATGGGCAG
TGGGGCTTGTTTGATAAACAATTTGGACGGACGGATACACAAGAGCCAGATCCA
GAAGGACGGATTCCGCAGTGGGAGAAAGCAACTGTCCAGGAAATGAAAGACAAGTTCAAAGCTGTTGGCTTCGGTCCTCGCCAG
CTAGCAGTTATGTCTGCATTCTTAGGTCCTGATCAA
GCAGCTACTGAGGCCTTACTTGCTACTGATCCAGAAGTTTTACCATGGGTTCAGAAGTACCAACGCAGCCGAGAAACAGTGTCCGAAACAGATTATGAG
GTGGATCTGATAACCACTCTC
ACCAAATTAAGTTGCTTGGGCCAACAAATCAATTATGAAGCTTACACATACCCTGTCCAAAAAATTGATGTGACCAAACTCAAATTATAG

Retrieve as FASTA