Entry information : MacuPrx10
Entry ID 9059
Creation 2011-07-01 (Qiang Li)
Last sequence changes 2016-01-12 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-01-12 (Achraf Jemmat)
Peroxidase information: MacuPrx10
Name MacuPrx10
Class Class III peroxidase    [Orthogroup: Prx012]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Musaceae Musa
Organism Musa acuminata (banana)    [TaxId: 4641 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MacuPrx10
start..stop
S start..stop
MacuPrx01 459 3e-164 1..326 1..323
CclPrx103 426 4e-151 5..326 6..323
CsPrx23 424 2e-150 2..326 3..323
PtPrx76 422 6e-150 18..326 11..316
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 93..320 228 N° 2 403..594 192 N° 3 680..1240 561  
join(93..320,403..594,680..1240)


exon

Literature and cross-references MacuPrx10
DNA ref. GenBank:   NC_025210.1 (28686243..28687389)
Cluster/Prediction ref. Genebank:   103998799
Protein sequence: MacuPrx10
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   327
PWM (Da):   %s   35593.09  
PI (pH):   %s   8.94
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSSARVSSFTQALLLASLLLFMTAMSCEAHLTPKYYAKSCPQALSTIRAAVRRAVERERRMAASLIRLHFHDCFVQGCDASLLLKDAEGIVSEQNAPQNFRSARGFEVIDSIKWAVEKVCPGVVSCADILAVAARDSSEYVGGPTWKVKLGRRDSTTAANKDLVQRDLPVAFDNLDELISSFARQGLSIKDMVALSGSHTIGQAQCATFRNRIYNEPNIDHGFAALRRRRCPSSQVLGNSTLAPLDLVTPNSFDNNYYKNLLQKKGLLHSDQVLLSHGPTGDMVKYYSKNQAAFFADFAAAMVKMGDIAPLTGSAGEVRRTCSAIN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 9, introns 1 and 2).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGTTCTGCAAGAGTTTCCAGCTTCACACAGGCATTGTTGCTGGCTTCGCTCTTACTGTTCATGACTGCAATGTCTTGTGAGGCGCATCTGACACCCAAGTACTACGCCAAGTCCTGC
CCGCAAGCTCTCTCGACCATCAGGGCTGCCGTGAGGCGCGCCGTCGAACGCGAGCGTCGCATGGCGGCGTCGCTTATCCGCCTCCATTTCCATGACTGCTTCGTTCAG
GTAAGCTTCAAG
CTTCTTCTTCCCCTTGCCATTCCCTCGTGTGCGCGCTCATCGGTTTCATATGCTCGGCCAACTTCGCCAGGGATGCGACGCGTCGCTCCTGCTCAAAGATGCCGAGGGCATCGTGAGCGA
ACAGAACGCGCCCCAGAACTTTAGATCAGCGAGAGGGTTCGAAGTCATCGACAGCATCAAGTGGGCGGTCGAGAAGGTGTGCCCGGGAGTGGTTTCTTGCGCCGACATCCTCGCCGTCGC
AGCGCGGGACTCATCGGAATAC
GTAAGCGCGCGCCATTATCATGTACTCTACTTGATGCCTCCATTCGAATTCCGGACGCGTTGAACTGTGAGCGATCCTTGAGCAGGTTGGTGGCCCGA
CATGGAAGGTGAAGCTTGGAAGAAGGGACTCCACCACTGCGGCCAACAAAGATTTGGTCCAGAGAGACCTGCCCGTAGCGTTCGACAACCTCGATGAGCTCATCTCCTCGTTTGCTCGCC
AAGGACTTAGCATCAAAGACATGGTTGCTCTGTCAGGTTCCCACACCATCGGCCAAGCTCAGTGCGCCACCTTCCGGAACAGGATCTACAACGAGCCCAACATCGACCATGGCTTCGCCG
CCCTGCGACGCCGACGGTGCCCCTCGTCACAGGTCCTCGGCAACAGCACCCTGGCGCCGCTGGACCTGGTCACGCCCAACTCGTTCGACAACAACTACTACAAGAACCTCCTTCAGAAGA
AGGGCCTGCTGCACTCCGACCAGGTGCTCCTCAGCCACGGGCCCACCGGCGACATGGTGAAGTACTACAGCAAGAACCAGGCGGCTTTCTTCGCCGACTTCGCGGCCGCAATGGTGAAGA
TGGGCGACATCGCCCCCCTCACTGGCTCAGCAGGGGAGGTCAGAAGGACTTGCAGCGCCATCAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGTTCTGCAAGAGTTTCCAGCTTCACACAGGCATTGTTGCTGGCTTCGCTCTTACTGTTCATGACTGCAATGTCTTGTGAGGCGCATCTGACACCCAAGTACTACGCCAAGTCCTGC
CCGCAAGCTCTCTCGACCATCAGGGCTGCCGTGAGGCGCGCCGTCGAACGCGAGCGTCGCATGGCGGCGTCGCTTATCCGCCTCCATTTCCATGACTGCTTCGTTCAG
GGATGCGACGCG
TCGCTCCTGCTCAAAGATGCCGAGGGCATCGTGAGCGAACAGAACGCGCCCCAGAACTTTAGATCAGCGAGAGGGTTCGAAGTCATCGACAGCATCAAGTGGGCGGTCGAGAAGGTGTGC
CCGGGAGTGGTTTCTTGCGCCGACATCCTCGCCGTCGCAGCGCGGGACTCATCGGAATAC
GTTGGTGGCCCGACATGGAAGGTGAAGCTTGGAAGAAGGGACTCCACCACTGCGGCCAAC
AAAGATTTGGTCCAGAGAGACCTGCCCGTAGCGTTCGACAACCTCGATGAGCTCATCTCCTCGTTTGCTCGCCAAGGACTTAGCATCAAAGACATGGTTGCTCTGTCAGGTTCCCACACC
ATCGGCCAAGCTCAGTGCGCCACCTTCCGGAACAGGATCTACAACGAGCCCAACATCGACCATGGCTTCGCCGCCCTGCGACGCCGACGGTGCCCCTCGTCACAGGTCCTCGGCAACAGC
ACCCTGGCGCCGCTGGACCTGGTCACGCCCAACTCGTTCGACAACAACTACTACAAGAACCTCCTTCAGAAGAAGGGCCTGCTGCACTCCGACCAGGTGCTCCTCAGCCACGGGCCCACC
GGCGACATGGTGAAGTACTACAGCAAGAACCAGGCGGCTTTCTTCGCCGACTTCGCGGCCGCAATGGTGAAGATGGGCGACATCGCCCCCCTCACTGGCTCAGCAGGGGAGGTCAGAAGG
ACTTGCAGCGCCATCAACTGA

Retrieve as FASTA