Entry information : MePrx104 (cassava4.1_028656m)
Entry ID 9064
Creation 2011-07-01 (Qiang Li)
Last sequence changes 2011-12-01 (Qiang Li)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2015-12-31 (Achraf Jemmat)
Peroxidase information: MePrx104 (cassava4.1_028656m)
Name (synonym) MePrx104 (cassava4.1_028656m)
Class Class III peroxidase    [Orthogroup: Prx012]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Manihot
Organism Manihot esculenta (cassava)    [TaxId: 3983 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MePrx104
start..stop
S start..stop
MePrx82 615 0 1..325 1..325
MePrx71 611 0 1..325 1..325
MePrx138 605 0 1..325 1..325
MePrx113 602 0 1..325 1..325
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 492104..492337 234 N° 2 492425..492616 192 N° 3 492715..492880 166 N° 4 493009..493391 383
join(492104..492337,492425..492616,492715..492880,493009..493391)


exon

Literature and cross-references MePrx104 (cassava4.1_028656m)
DNA ref. Phytozome 12:   scaffold08799 (492104..493391)
Protein sequence: MePrx104 (cassava4.1_028656m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   325 (294)
PWM (Da):   %s   34770.63 (31619.0)  
PI (pH):   %s   7.94 (7.98) Peptide Signal:   %s   cut: 32 range:32-325
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
METSVHNVLTSPAKAAAVVFAVLLLSTVCQAQLTSTFYDNSCPNALSTIRTSIRNSIAAERRMAASLIRLHFHDCFVQGCDASILLEETPTIESEQTALPNKDSARGYRVIEKAKSEVEKICPGVVSCADILAVAARDASAYVGGPSYTVRLGRRDSTTASRTLANSQLPSFKDGLDRLISSFQNKGLSPRDLVALSGAHTLGHAQCFTFRDRIYSNVSIDAGFASTRKRTCPAVGGDANLAPFDLVTPNSFDNNYFKNLIQLKGLLESDQVLFSGGSTDSIVREYSRSPAAFNSDFATAMIKMGNIDILTGTAGEIRKICSAI

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAAACTTCAGTTCATAACGTTTTGACATCTCCAGCAAAAGCAGCAGCTGTTGTATTTGCGGTGCTGCTCTTGAGCACAGTATGCCAGGCTCAACTCACCTCTACGTTTTATGATAAT
TCCTGTCCGAATGCACTTAGTACTATCCGAACTTCCATCAGAAATTCAATTGCCGCAGAACGAAGAATGGCAGCTTCTCTCATTCGTCTCCACTTTCATGATTGCTTTGTTCAG
GTACAA
TATATGTATTGCTCTGTTCTCCTTCCAAATATAATTAGTTTTATTCTATGAGCATCGCTTAATGAATTCTTGATCTTGCAGGGTTGTGATGCATCAATCTTACTCGAAGAGACTCCAACT
ATCGAGAGCGAACAAACTGCACTTCCCAATAAAGATTCTGCCAGAGGCTATCGAGTCATTGAGAAAGCAAAATCTGAAGTAGAGAAAATATGCCCCGGAGTTGTATCTTGTGCAGATATC
CTCGCTGTGGCAGCAAGAGATGCATCTGCATAT
GTAATTAACTATATTTCAAACTCTTGCGTTCAGATGCTATACTCTTCTCAGGTTATTGTTTATTAATTTTTTTGACATTTAATTCTG
AAATATATTAGGTGGGAGGTCCATCTTATACAGTGAGGCTTGGAAGAAGAGACTCAACAACTGCTAGTAGAACTCTTGCCAATAGTCAACTTCCCAGTTTTAAAGATGGCCTGGACAGAC
TTATATCTAGCTTTCAGAATAAAGGCCTTAGCCCAAGGGATCTGGTTGCCTTGTCAG
GTGTATATGCTAAAACTATTTTCATATATTTTATATAATCATATATATTACAAGTGATCTTTT
TCCTATAGCAAAAAAGAGTTTCTTGGCTTTTATAATGCTAAAAATATTTTAATCTCCAAATGCAGGAGCTCATACTCTAGGCCACGCTCAATGCTTTACATTCCGCGATAGGATATACAG
CAACGTTTCCATTGACGCTGGATTTGCAAGCACTCGCAAGCGCACTTGTCCAGCTGTTGGCGGTGATGCAAACTTGGCTCCCTTTGATTTGGTCACACCTAATTCTTTCGACAACAATTA
CTTCAAGAATCTTATACAACTGAAAGGTCTTCTTGAATCTGATCAAGTTCTTTTTAGCGGAGGCTCGACAGATAGCATTGTCCGAGAATATAGCAGGAGTCCTGCAGCTTTCAACTCAGA
CTTTGCTACTGCTATGATCAAAATGGGAAATATCGATATTCTCACTGGCACTGCTGGGGAAATAAGGAAGATCTGCAGTGCTATCAAT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAAACTTCAGTTCATAACGTTTTGACATCTCCAGCAAAAGCAGCAGCTGTTGTATTTGCGGTGCTGCTCTTGAGCACAGTATGCCAGGCTCAACTCACCTCTACGTTTTATGATAAT
TCCTGTCCGAATGCACTTAGTACTATCCGAACTTCCATCAGAAATTCAATTGCCGCAGAACGAAGAATGGCAGCTTCTCTCATTCGTCTCCACTTTCATGATTGCTTTGTTCAG
GGTTGT
GATGCATCAATCTTACTCGAAGAGACTCCAACTATCGAGAGCGAACAAACTGCACTTCCCAATAAAGATTCTGCCAGAGGCTATCGAGTCATTGAGAAAGCAAAATCTGAAGTAGAGAAA
ATATGCCCCGGAGTTGTATCTTGTGCAGATATCCTCGCTGTGGCAGCAAGAGATGCATCTGCATAT
GTGGGAGGTCCATCTTATACAGTGAGGCTTGGAAGAAGAGACTCAACAACTGCT
AGTAGAACTCTTGCCAATAGTCAACTTCCCAGTTTTAAAGATGGCCTGGACAGACTTATATCTAGCTTTCAGAATAAAGGCCTTAGCCCAAGGGATCTGGTTGCCTTGTCAG
GAGCTCAT
ACTCTAGGCCACGCTCAATGCTTTACATTCCGCGATAGGATATACAGCAACGTTTCCATTGACGCTGGATTTGCAAGCACTCGCAAGCGCACTTGTCCAGCTGTTGGCGGTGATGCAAAC
TTGGCTCCCTTTGATTTGGTCACACCTAATTCTTTCGACAACAATTACTTCAAGAATCTTATACAACTGAAAGGTCTTCTTGAATCTGATCAAGTTCTTTTTAGCGGAGGCTCGACAGAT
AGCATTGTCCGAGAATATAGCAGGAGTCCTGCAGCTTTCAACTCAGACTTTGCTACTGCTATGATCAAAATGGGAAATATCGATATTCTCACTGGCACTGCTGGGGAAATAAGGAAGATC
TGCAGTGCTATCAAT

Retrieve as FASTA