Entry information : PtPrx01 (POPTR_0003s21640 / Potri.003G214700)
Entry ID 907
Creation 2006-06-23 (Christophe Dunand)
Last sequence changes 2006-06-23 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-03-07 (Qiang Li)
Peroxidase information: PtPrx01 (POPTR_0003s21640 / Potri.003G214700)
Name (synonym) PtPrx01 (POPTR_0003s21640 / Potri.003G214700)
Class Class III peroxidase    [Orthogroup: Prx005]
Taxonomy Eukaryota Viridiplantae Streptophyta Salicaceae Populus
Organism Populus trichocarpa (Western balsam poplar)    [TaxId: 3694 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtPrx01
start..stop
S start..stop
PtPrx98 645 0 1..345 2..349
PalPrx03 638 0 25..345 1..321
PkPrx03 625 0 1..345 2..347
HbPrx01 503 0 9..345 8..346
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 19719653..19719877 225 N° 2 19719980..19720171 192 N° 3 19720398..19720566 169 N° 4 19720641..19721092 452
join(19719653..19719877,19719980..19720171,19720398..19720566,19720641..19721092 )


exon

Literature and cross-references PtPrx01 (POPTR_0003s21640 / Potri.003G214700)
Literature Christensen,J.H., et al; The syringaldazine-oxidizing peroxidase PXP 3-4 from poplar xylem: cDNA isolation, characterization and expression
Plant Mol. Biol. 47 (5), 581-593 (2001).
Protein ref. UniProtKB:   Q43102
DNA ref. Phytozome 12:   scaffold_3 (19719653..19721092)
mRNA ref. GenBank:   X97351
Omic ref. ePlant:   Potri.003G214700
Protein sequence: PtPrx01 (POPTR_0003s21640 / Potri.003G214700)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   345 (317)
PWM (Da):   %s   36512.13 (33404.5) Transmb domain:   %s   i5-27o
PI (pH):   %s   4.52 (4.43) Peptide Signal:   %s   cut: 29 range:29-345
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MIDKALHPLVASLFFVIWFGGSLPYAYAQLTPTFYDGTCPNVSTIIRGVLAQALQTDPRIGASLIRLHFHDCFVDGCDGSILLDNTDTIESEKEAAPNNNSARGFDVVDNMKAAVENACPGIVSCADILAIAAEESVRLAGGPSWTVPLGRRDSLIANRSGANSSIPAPSESLAVLKSKFAAVGLNTSSDLVALSGAHTFGRAQCLNFISRLYNFSGSGNPDPTLNTTYLAALQQLCPQGGNRSVLTNLDRTTPDTFDGNYFSNLQTNEGLLQSDQELFSTTGADTIAIVNNFSSNQTAFFESFVVSMIRMGNISPLTGTDGEIRLNCRIVNNSTGSNALLVSSI

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns) and 8 ESTs (DT496904, DT498346, CV251257, DT498795, CV249653, CV252106, CV250877, DT499906). Sub_species="Trichobel". Contig contains 4 other peroxidase sequences.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATAGATAAAGCCTTGCATCCTTTAGTTGCATCTCTTTTTTTTGTAATCTGGTTTGGAGGATCACTTCCCTATGCCTATGCTCAGCTGACTCCCACATTCTACGATGGAACATGCCCG
AATGTGAGCACCATCATTCGAGGAGTCCTTGCTCAGGCTTTGCAGACAGATCCCAGGATTGGAGCCAGCCTCATTCGACTTCATTTCCATGATTGTTTTGTTGAT
GTAACCATCTGTATA
ACTAATTATGTTATTTTTCTAACGTTGTTAGATAATCATAGATATTGTTTCTTGAACTTCAAGTGTTAATTACCAAGCTTGGTTCAGGGTTGTGATGGATCAATTCTTTTGGACAACACT
GATACTATAGAGAGTGAGAAAGAAGCTGCTCCAAATAATAATTCAGCAAGGGGTTTTGATGTTGTTGATAACATGAAGGCTGCAGTAGAGAATGCTTGCCCTGGGATAGTTTCTTGTGCT
GATATTCTCGCCATTGCAGCTGAAGAGTCTGTTCGTTTG
GTATGTTAATGATTTCTCTTTCCTGTAACTTCTCAAACCTCAGTGAATTCAAAGAAAGAGGAGAAAGCAAAGAGATTTGTT
TTTTATTTTTGTCAAATCATGGACTACTAATATGCTAATTTCTTTGAACCTAAAATTGAAAATGTGCTAATCTACGTGTCTTTGCTGCAGCTTCTTGTTTTTGGATACATTGTTGTTTGC
TTCTTAAATTAATGTTTGATCACAGGCAGGAGGACCCTCATGGACAGTTCCTTTGGGAAGAAGAGACAGCTTAATAGCAAACAGAAGTGGTGCTAATTCTTCCATTCCGGCTCCCTCCGA
GAGCCTTGCTGTTCTCAAATCCAAGTTTGCAGCCGTGGGCCTCAACACCAGTAGTGACCTGGTTGCCCTTTCAG
GCATGTCTTTGTTAGTATTCTAGTGATCCATTTATTTCTTGTTCCA
AGGTTAATTTGACGTGCATGTTTTTCAGGTGCTCACACATTTGGAAGAGCTCAATGTTTAAATTTCATCAGTAGATTGTATAATTTTAGTGGCAGTGGCAATCCTGATCCAACATTGAAC
ACAACCTATCTAGCAGCACTTCAACAATTATGTCCTCAAGGTGGAAATCGGAGTGTTTTAACAAACCTTGATCGCACTACACCCGATACTTTCGATGGCAACTATTTTTCCAATCTTCAA
ACCAATGAAGGCCTGCTTCAGAGTGATCAAGAGTTGTTCTCTACTACAGGTGCCGATACCATTGCCATTGTCAACAATTTTAGTAGTAATCAGACTGCATTCTTTGAAAGCTTTGTGGTG
TCCATGATTAGAATGGGGAATATTAGCCCCTTAACTGGGACAGATGGAGAGATCAGATTGAATTGCAGAATAGTCAACAACTCAACTGGATCAAATGCTCTTCTGGTTAGCTCAATTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATAGATAAAGCCTTGCATCCTTTAGTTGCATCTCTTTTTTTTGTAATCTGGTTTGGAGGATCACTTCCCTATGCCTATGCTCAGCTGACTCCCACATTCTACGATGGAACATGCCCG
AATGTGAGCACCATCATTCGAGGAGTCCTTGCTCAGGCTTTGCAGACAGATCCCAGGATTGGAGCCAGCCTCATTCGACTTCATTTCCATGATTGTTTTGTTGAT
GGTTGTGATGGATCA
ATTCTTTTGGACAACACTGATACTATAGAGAGTGAGAAAGAAGCTGCTCCAAATAATAATTCAGCAAGGGGTTTTGATGTTGTTGATAACATGAAGGCTGCAGTAGAGAATGCTTGCCCT
GGGATAGTTTCTTGTGCTGATATTCTCGCCATTGCAGCTGAAGAGTCTGTTCGTTTG
GCAGGAGGACCCTCATGGACAGTTCCTTTGGGAAGAAGAGACAGCTTAATAGCAAACAGAAGT
GGTGCTAATTCTTCCATTCCGGCTCCCTCCGAGAGCCTTGCTGTTCTCAAATCCAAGTTTGCAGCCGTGGGCCTCAACACCAGTAGTGACCTGGTTGCCCTTTCAG
GTGCTCACACATTT
GGAAGAGCTCAATGTTTAAATTTCATCAGTAGATTGTATAATTTTAGTGGCAGTGGCAATCCTGATCCAACATTGAACACAACCTATCTAGCAGCACTTCAACAATTATGTCCTCAAGGT
GGAAATCGGAGTGTTTTAACAAACCTTGATCGCACTACACCCGATACTTTCGATGGCAACTATTTTTCCAATCTTCAAACCAATGAAGGCCTGCTTCAGAGTGATCAAGAGTTGTTCTCT
ACTACAGGTGCCGATACCATTGCCATTGTCAACAATTTTAGTAGTAATCAGACTGCATTCTTTGAAAGCTTTGTGGTGTCCATGATTAGAATGGGGAATATTAGCCCCTTAACTGGGACA
GATGGAGAGATCAGATTGAATTGCAGAATAGTCAACAACTCAACTGGATCAAATGCTCTTCTGGTTAGCTCAATTTAA

Retrieve as FASTA