Entry information : MePrx114 (cassava4.1_030116m)
Entry ID 9072
Creation 2011-07-01 (Qiang Li)
Last sequence changes 2011-12-01 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-01-06 (Christophe Dunand)
Peroxidase information: MePrx114 (cassava4.1_030116m)
Name (synonym) MePrx114 (cassava4.1_030116m)
Class Class III peroxidase    [Orthogroup: Prx016]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Manihot
Organism Manihot esculenta (cassava)    [TaxId: 3983 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MePrx114
start..stop
S start..stop
RcPrx74 575 0 18..320 15..318
CpapPrx26 564 0 8..319 10..321
CsPrx27 562 0 8..320 5..317
CclPrx51 556 0 8..320 5..317
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 235945..236157 213 N° 2 236252..236440 189 N° 3 236671..236833 163 N° 4 236916..237310 395
join(235945..236157,236252..236440,236671..236833,236916..237310)


exon

Literature and cross-references MePrx114 (cassava4.1_030116m)
DNA ref. Phytozome 11:   scaffold07012 (235945..237310)
Protein sequence: MePrx114 (cassava4.1_030116m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   320 (295)
PWM (Da):   %s   34204.29 (31779.9) Transmb domain:   %s   i5-27o
PI (pH):   %s   8.22 (8.22) Peptide Signal:   %s   cut: 26 range:26-320
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAAAFVALALVLALVIFPMASPVGALSFNYYDHTCPQLESTVTSAVKKAMMNDKTVPAALLRMHFHDCFIRGCDGSVLLESEGKNKAEKDGPPNISLHAFYVIDNAKKAVEAECPGLVSCADILALAARDAIALSGGPNWDVPKGRKDGRISKASDTRQLPGPNFNISQLQQSFSQRGLSLEDLVALSGGHSLGFSHCSSFQNRIHNFNSSLDIDPTLNPSFAASLRNACPMHNKVKNAGATLDSSTTIFDNAYYKLLLQGKSLFSSDQSLLTTPKTSALVSKFASSQQEFEKAFVKSMIKMSSISGGGQEIRLDCKVV

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGCTGCCTTTGTGGCTCTTGCTCTTGTGCTGGCCCTTGTGATTTTTCCCATGGCTTCTCCTGTGGGTGCACTCAGCTTCAACTACTATGACCACACCTGCCCTCAGCTCGAGTCC
ACTGTTACTAGTGCCGTTAAAAAAGCTATGATGAATGATAAAACAGTTCCGGCTGCACTGCTTCGGATGCATTTTCATGACTGTTTTATTAGA
GTATATAATTGTTTTACCATTTTGTTT
CTAAAGTTCTTGAAAGTTGACAGTAGTTTCATGCAAATTCTTACGAGTTTATACATATATTGTTAAGGGTTGTGATGGTTCTGTGCTCCTGGAATCGGAAGGAAAGAACAAGGCAGAGAA
AGATGGGCCTCCTAACATTTCATTGCATGCTTTTTATGTTATTGATAATGCAAAGAAAGCAGTGGAAGCTGAATGCCCTGGCTTGGTTTCCTGTGCTGATATTTTGGCTCTAGCTGCCAG
GGACGCTATCGCTTTG
GTTAGTTCCAACACTAGTATTAGGAGATAATACTTATCTGAATTTGGTCCAACCAAATACAAATAAGTGAATTTTTATGAAAAAAAAAAAAAAAGATGCGAAGA
TCTATAATAGACCAAGTCGACCTAAGAATTTCCACTGCATTAGTATTTTTGACTTGTTGGAATGTTCTATATTTGTTTATGACAACCTTTGTAATGGTCCCATTTTGGTTTGGCCTTGTG
TAACAGTCTGGAGGTCCCAATTGGGATGTGCCCAAAGGAAGAAAGGATGGAAGAATTTCAAAGGCAAGTGACACCAGGCAATTGCCGGGTCCCAACTTTAACATTTCTCAATTACAGCAA
AGCTTCTCTCAGAGAGGACTTTCGTTGGAAGATCTAGTGGCTCTCTCAG
GTAACTTCAGCAATAAACTTAATTAACCATTGCATAATGAGAAGATACATTAAAAGGGAAAAAAAAATTTA
CATGTGTGTAGGGGGTCACAGTCTTGGATTCTCCCACTGTTCTTCCTTCCAGAACAGAATCCACAACTTCAATTCCAGTCTTGACATCGACCCGACATTGAACCCATCATTTGCAGCGAG
TTTAAGGAATGCATGTCCCATGCACAACAAGGTTAAAAATGCTGGTGCTACGTTGGATTCATCGACGACAATATTCGACAACGCTTACTACAAGCTACTTCTCCAAGGCAAGAGCCTTTT
CTCTTCGGATCAATCCCTACTCACAACCCCAAAAACCAGCGCTTTAGTTTCCAAGTTTGCGAGCTCCCAGCAAGAGTTTGAGAAGGCCTTTGTGAAGTCCATGATCAAGATGAGTAGTAT
AAGTGGTGGTGGACAAGAGATTAGGCTAGATTGTAAAGTAGTTAAT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGCTGCCTTTGTGGCTCTTGCTCTTGTGCTGGCCCTTGTGATTTTTCCCATGGCTTCTCCTGTGGGTGCACTCAGCTTCAACTACTATGACCACACCTGCCCTCAGCTCGAGTCC
ACTGTTACTAGTGCCGTTAAAAAAGCTATGATGAATGATAAAACAGTTCCGGCTGCACTGCTTCGGATGCATTTTCATGACTGTTTTATTAGA
GGTTGTGATGGTTCTGTGCTCCTGGAA
TCGGAAGGAAAGAACAAGGCAGAGAAAGATGGGCCTCCTAACATTTCATTGCATGCTTTTTATGTTATTGATAATGCAAAGAAAGCAGTGGAAGCTGAATGCCCTGGCTTGGTTTCCTGT
GCTGATATTTTGGCTCTAGCTGCCAGGGACGCTATCGCTTTG
TCTGGAGGTCCCAATTGGGATGTGCCCAAAGGAAGAAAGGATGGAAGAATTTCAAAGGCAAGTGACACCAGGCAATTG
CCGGGTCCCAACTTTAACATTTCTCAATTACAGCAAAGCTTCTCTCAGAGAGGACTTTCGTTGGAAGATCTAGTGGCTCTCTCAG
GGGGTCACAGTCTTGGATTCTCCCACTGTTCTTCC
TTCCAGAACAGAATCCACAACTTCAATTCCAGTCTTGACATCGACCCGACATTGAACCCATCATTTGCAGCGAGTTTAAGGAATGCATGTCCCATGCACAACAAGGTTAAAAATGCTGGT
GCTACGTTGGATTCATCGACGACAATATTCGACAACGCTTACTACAAGCTACTTCTCCAAGGCAAGAGCCTTTTCTCTTCGGATCAATCCCTACTCACAACCCCAAAAACCAGCGCTTTA
GTTTCCAAGTTTGCGAGCTCCCAGCAAGAGTTTGAGAAGGCCTTTGTGAAGTCCATGATCAAGATGAGTAGTATAAGTGGTGGTGGACAAGAGATTAGGCTAGATTGTAAAGTAGTTAAT

Retrieve as FASTA