Entry information : MePrx116 (cassava4.1_030211m)
Entry ID 9074
Creation 2011-07-01 (Qiang Li)
Last sequence changes 2011-12-01 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-01-06 (Christophe Dunand)
Peroxidase information: MePrx116 (cassava4.1_030211m)
Name (synonym) MePrx116 (cassava4.1_030211m)
Class Class III peroxidase     [Orthogroup: Prx014]*
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Manihot
Organism Manihot esculenta (cassava)    [TaxId: 3983 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value MePrx116
start..stop
S start..stop
MePrx29 468 7e-168 1..326 1..325
RcPrx85 433 4e-154 1..326 1..320
MePrx109 412 6e-146 1..326 1..321
CclPrx85 408 2e-144 1..326 1..317
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 178398..178622 225 N° 2 178130..178321 192 N° 3 177883..178048 166 N° 4 177396..177790 395
complement(join(177396..177790,177883..178048,178130..178321,178398..178622))


exon

Literature and cross-references MePrx116 (cassava4.1_030211m)
DNA ref. Phytozome 12:   scaffold07035 (178622..177396)
Protein sequence: MePrx116 (cassava4.1_030211m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   326 (299)
PWM (Da):   %s   34721 (31800.6) Transmb domain:   %s   i7-29o34-56i (i7-29o)
PI (pH):   %s   4.54 (4.47) Peptide Signal:   %s   cut: 28 range:28-326
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASRSSVLFTGFMTFLIMTLCSLPSQAQLSDETFYALSCPAAVATISTTVSLAVLNDTRMAASLIRLHFHDCFVQGCDASVLLDDTPSMIGEKTSIFNDKSLRGFEVIDDIKSQLQSLCPGVVSCADIVTVAARDASVAVGGPTWSVNLGRRDSLTASKTMADSSLPRFTDSVQQLTDSFASKNLTQRDMVALSGSHTVGQAHCATFRDRVNSNTSDIDSEFGRSLREDLPCPADGSGDGNLAPLDLATPNTFDNSFFKNLVDKKGLLQSDQVLFSGGATDSIVMEYADNTLTFRSDFAAAMVQMGKISPLTGTQGQIRTFCNVV

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCTCGTTCATCTGTTCTCTTCACTGGTTTCATGACATTCTTGATAATGACTCTGTGTAGCTTGCCATCTCAAGCTCAGCTTTCTGATGAAACCTTCTATGCCTTGTCATGTCCT
GCTGCCGTAGCAACTATTAGTACAACTGTTAGTCTAGCCGTCTTGAATGACACCAGAATGGCTGCTTCGCTCATTCGTCTTCATTTCCATGATTGCTTTGTCCAG
GTAATTACAAAATCA
CTTGATATTTGTCTAATTATTAAGCTGAATTAGCTGTCATCTTATGAATTTTGTATTTCAGGGTTGTGATGCCTCAGTTTTGCTGGATGACACGCCATCAATGATTGGAGAGAAAACTTC
AATCTTCAATGACAAATCTCTCAGAGGATTTGAAGTCATAGATGATATCAAATCTCAGTTGCAGAGCCTATGTCCAGGAGTTGTTTCATGTGCTGATATTGTTACAGTAGCAGCTCGTGA
TGCATCTGTTGCT
GTAAGTGACCATCATTTTAACCTCTTCAATTATTAGGCTTATTCTAGCTATATATTTATTCATATACTCTCTCATACATAGGTTGGTGGACCGACATGGTCTGTGAA
TCTTGGAAGAAGAGACTCCCTCACCGCAAGCAAAACCATGGCTGATAGCAGCCTTCCTCGCTTTACAGATTCTGTTCAGCAACTCACTGACTCGTTCGCTAGCAAGAATCTAACTCAAAG
AGATATGGTTGCCCTCTCAG
GTTTGTGCCTTGGTGATTAACATATATATAGTTTCAAATATTATTATATGTGGATAATGTAATTTCTAGATATACTATTTGGCATCATATAGGGTCGCAT
ACAGTTGGGCAAGCACATTGCGCCACCTTCCGTGATAGAGTTAACAGCAACACGAGTGATATTGATTCTGAGTTTGGTAGGAGTCTAAGGGAAGATCTTCCATGCCCAGCTGATGGCTCA
GGGGATGGAAATCTTGCACCATTGGATTTAGCGACTCCCAATACTTTTGATAACAGTTTCTTCAAGAACCTTGTTGATAAAAAGGGTCTTCTTCAATCAGATCAGGTTCTTTTCAGCGGT
GGTGCTACAGACAGCATTGTTATGGAGTACGCGGACAACACTTTAACCTTCAGATCTGATTTTGCAGCGGCCATGGTTCAGATGGGAAAAATAAGCCCCTTAACTGGTACTCAAGGCCAG
ATACGCACTTTCTGTAATGTCGTCAAC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCTCGTTCATCTGTTCTCTTCACTGGTTTCATGACATTCTTGATAATGACTCTGTGTAGCTTGCCATCTCAAGCTCAGCTTTCTGATGAAACCTTCTATGCCTTGTCATGTCCT
GCTGCCGTAGCAACTATTAGTACAACTGTTAGTCTAGCCGTCTTGAATGACACCAGAATGGCTGCTTCGCTCATTCGTCTTCATTTCCATGATTGCTTTGTCCAG
GGTTGTGATGCCTCA
GTTTTGCTGGATGACACGCCATCAATGATTGGAGAGAAAACTTCAATCTTCAATGACAAATCTCTCAGAGGATTTGAAGTCATAGATGATATCAAATCTCAGTTGCAGAGCCTATGTCCA
GGAGTTGTTTCATGTGCTGATATTGTTACAGTAGCAGCTCGTGATGCATCTGTTGCT
GTTGGTGGACCGACATGGTCTGTGAATCTTGGAAGAAGAGACTCCCTCACCGCAAGCAAAACC
ATGGCTGATAGCAGCCTTCCTCGCTTTACAGATTCTGTTCAGCAACTCACTGACTCGTTCGCTAGCAAGAATCTAACTCAAAGAGATATGGTTGCCCTCTCAG
GGTCGCATACAGTTGGG
CAAGCACATTGCGCCACCTTCCGTGATAGAGTTAACAGCAACACGAGTGATATTGATTCTGAGTTTGGTAGGAGTCTAAGGGAAGATCTTCCATGCCCAGCTGATGGCTCAGGGGATGGA
AATCTTGCACCATTGGATTTAGCGACTCCCAATACTTTTGATAACAGTTTCTTCAAGAACCTTGTTGATAAAAAGGGTCTTCTTCAATCAGATCAGGTTCTTTTCAGCGGTGGTGCTACA
GACAGCATTGTTATGGAGTACGCGGACAACACTTTAACCTTCAGATCTGATTTTGCAGCGGCCATGGTTCAGATGGGAAAAATAAGCCCCTTAACTGGTACTCAAGGCCAGATACGCACT
TTCTGTAATGTCGTCAAC

Retrieve as FASTA